Your privacy, your choice

We use essential cookies to make sure the site can function. We also use optional cookies for advertising, personalisation of content, usage analysis, and social media.

By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection.

See our privacy policy for more information on the use of your personal data.

for further information and to change your choices.
Skip to main content
Download PDF

Microglial depletion decreases Müller cell maturation and inner retinal vascular density

Cell Communication and Signaling volume 23, Article number: 90 (2025) Cite this article

Abstract

Background

The neuroretinal vascular system is comprised of three interconnected layers. The initial superficial vascular plexus formation is guided by astrocytes around birth in mice. The formation of the deep and intermediate vascular plexuses occurs in the second postnatal week and is driven by Müller-cell-derived angiogenic signaling. Previously, we reported that microglia play an important role in regulating astrocyte density during superficial vascular plexus formation. Here, we investigated the role of microglia in regulating Müller-cell-dependent inner retinal vascular development.

Methodology

In this study, we depleted microglia during retinal development using Csf1R antagonist (PLX5622). We characterized the developmental progression of inner retinal vascular growth, effect of microglial depletion on inner retinal vascular growth and Müller cell marker expressions by immunostaining. Differential expressions of genes in the control and microglia depleted groups were analyzed by mRNA-seq and qPCR. Unpaired t-test was performed to determine the statistical differences between groups.

Results

This study show that microglia interact with Müller cells and the growing inner retinal vasculature. Depletion of microglia resulted in reduced inner retinal vascular layers densities and decreased Vegfa isoforms transcript levels. RNA-seq analysis further revealed that microglial depletion significantly reduced specific Müller cell maturation markers including glutamine synthetase, responsible for glutamine biosynthesis, necessary for angiogenesis.

Conclusions

Our study reveals an important role for microglia in facilitating inner retinal angiogenesis and Müller cell maturation.

Introduction

The development of an intricate vascular network is important for the growth and survival of highly energy-demanding neural tissues such as the retina [1,2,3]. The retinal vascular system is comprised of the interconnected superficial, intermediate, and deep vascular plexuses [1, 3]. The growth of this complex three-layered vascular network is tightly regulated by multicellular interactions at distinct retinal developmental stages [2, 4,5,6,7]. In mice, during the first postnatal week, endothelial tip cells that emerge through the optic nerve head follow the astrocyte matrices to form the superficial vascular layer [5, 6, 8, 9]. Starting from the second postnatal week, endothelial tip cells that arise from the superficial vascular network penetrate into the retina by following the Müller-cell-derived cues to form the deep and intermediate vascular plexuses [1, 2, 10,11,12].

Müller cells are the most abundant intrinsically-derived glial cell type, which spans almost the entire thickness of the retina [13]. Müller cells regulate a wide variety of retinal functions including the regulation of inner retinal vascular growth and maintenance of the blood retinal barrier [10, 14]. The morphogenesis of Müller cells begins at the end of the first postnatal week and continues to elaborate in the second postnatal week ahead of the inner retinal vascular developmental process [13]. Müller-cell-derived cues, such as vascular endothelial growth factor-a (Vegfa), attract the endothelial tip cells to penetrate the retina to form the inner retinal vascular layers [2, 10]. Müller cell specific deletion of transcription factor hypoxia-inducible factor (Hif) 2 alpha or Hif responsive Vegfa during development leads to poor inner retinal vascular growth [10]. Even in adulthood, ablation of Müller cells in the retina results in vascular abnormalities and the breakdown of the blood-neural barrier [14]. This suggests that Müller cells play an important role in regulating inner retinal vascular growth and maintaining vascular integrity.

Besides Müller cells, microglia, the resident immune cell type, also closely interact with the endothelial tip cells and regulate vascular density during the course of the inner retinal vascularization process [15, 16]. In particular, microglia that are located around the endothelial tip cells during the formation of the inner retinal vascular layers, modulate vascular density through non-canonical Wnt signaling and Tgfb1 levels [15, 16]. Deletion of microglial Wnt ligand transporter (Wntless) or microglia-dependent Tgfb1 signaling during the growth of the inner retinal vasculature results in excessive and abnormal vascular patterning [15, 16]. This implies that the microglia-derived cues are necessary for defining the density of the inner retinal vascular networks.

During the superficial vascular developmental process, prior studies, including ours, reported that microglia engulf and eliminate dying astrocytes in part through complement activation and facilitate the formation of spatially organized astrocyte/superficial vascular networks [6, 17]. The intercellular interactions between Müller cells and microglia have been shown to facilitate the clearance of apoptotic cells during retinal development [18]. It remains unclear if microglial-Müller cell interactions also modulate the density or the development of the deep and intermediate vascular plexuses in the retina. To investigate this, we explored the regulatory role of microglial-Müller cell crosstalk during the development of the inner retinal vascular layers.

Methods

Mice and microglia depletion

C57BL6/J breeding pairs were purchased from Jackson Laboratories (stock # 00664, Bar Harbor, ME). Retinas were collected at P7, P10, and P15 for further analysis. For microglia depletion, timed-pregnant females at gestational day 13 or 14 were maintained on a control chow diet (AIN-76 A) or chow diet incorporated with Csf1r inhibitor (AIN-76 A formulated at 1200 ppm) (PLX5622, Plexxikon Inc. Berkeley, CA). Retinas were collected from the control and microglia-depleted (PLX5622) groups at P10 and P15 and used for downstream studies.

RNA extraction and qPCR

RNA extraction and qPCR assays were performed as previously described [6, 19]. In brief, eyes were enucleated and dissected in ice-cold 1x PBS to extract the retinas. The RNA from the retinas was extracted using RNA-Stat-60 (Catalog# CS111, Tel Test Inc., Friendswood, TX) as per the manufacturer’s instructions. RNA concentrations were determined using the NanoDrop™ and the cDNA library was constructed using SuperScript™ IV VILO™ Master Mix (Catalog# 11756050, ThermoFisher Scientific, Waltham, MA). Real-time PCR reactions were performed in the CFX384™ Real-time PCR platform (Bio-Rad, Hercules, CA) using SYBR Green master mix (Applied biosystems, ThermoFischer Scientific, Foster City, CA) to determine the relative expression level of Kir4.1, Aqp4, Glul, Vegf120, Vegf164, and Vegf188. Sequences of primers used:

Ppia (TTCACCTTCCCAAAGACCAC, CAAACACAAACGGTTCCCAG),

Kir4.1 (GCCCCGTCTGTTCATCT, TGTAATAGACCTTAGCGACCGA),

Aqp4 (GGAAGGCATGAGTGACAGAG, TCCAGACTCCTTTGAAAGCC),

Glul (CATCCTGTTGCCATGTTTCG, CTCACCATGTCCATTATCCGTT),

Vegf120 (GCCAGCACATAGGAGAGATGAGC, CGGCTTGTCACATTTTTCTGG), Vegf164 (GCCAGCACATAGGAGAGATGAGC, CAAGGCTCACAGTGATTTTCTGG),

Vegf188 (GCCAGCACATAGGAGAGATGAGC and AACAAGGCTCACAGTGAACGCT).

RNA-seq

Poly A mRNA isolation and sequencing was performed as described previously [6]. Briefly, RNA was extracted as mentioned above from P10 control and microglia-depleted retinas, and the RNA integrity was examined using by Bioanalyzer (Agilent 2100). The RIN values of RNA used for cDNA library construction were > 9.0. The RNA samples were treated with oligo d-T attached magnetic beads (NEBNext®) to pull down mRNA and used for cDNA library construction using NEBNext ultra II directional RNA library prep kit for Illumina as recommended by the manufacturer (New England Biolabs, Inc, Ipswich, MA). The quality of the cDNA libraries were assessed on the TapeStation (Agilent) and the libraries were sequenced using Illumina Nextseq 2000 platform with a target of 25 million reads per sample.

For data analysis, STAR aligner was used for transcriptome mapping [20] and the mm9 assembly of the mouse reference genome. HTseq was used for obtaining individual Read counts [21] and the GENCODE M1 (NCBIM37) was used for gene annotation. EdgeR package was used for determining the differential expression of genes [22] after normalizing read counts and including only genes with CPM > 1 for at least one sample. Differentially expressed genes were defined based on the criteria of > 1.5-fold change in normalized expression and false discovery rate (FDR) < 0.05. Heatmaps and PCA plots were generated using normalized gene expression values (log2 FPKM) and the Heatmaps were generated using the R package pheatmap [23]. The pathway enrichment analysis of differentially expressed genes was performed using Ingenuity® Pathway Analysis tool (Qiagen) version 01-23-01.

Flatmount preparation and immunostaining

Flatmount preparations were performed as described previously [5, 6]. Briefly, 4% Paraformaldehyde (BosterBio, Pleasanton, CA) fixed eyes (for 10 min), were dissected in 1x PBS and the retinal flatmounts were stored in ice-cold 100% methanol. Prior to staining, retinal flatmounts were washed in 1x PBS and then blocked (10% fetal bovine serum, 0.05%triton-X100, and 0.01% sodium azide in 1X PBS) for 2 h at room temperature. Following blocking, retinal flatmounts were incubated with primary antibodies (see list below) for 24–36 h at 4° C. After extensive washes in 1X-PBS, retinal flatmounts were incubated with respective secondary antibodies (see list below) for 4 h at room temperature or overnight at 4° C. Following washes, retinal flatmounts were mounted onto slides using ProLong Gold anti-fade reagent (Invitrogen, Waltham, MA).

Primary antibodies used: goat anti-CD31 (1:500, Catalog # AF3628, R&D Systems, Inc. Minneapolis, MN). Isolectin b4 (1:250, Catalog#I21411, ThermoFisher Scientific, Waltham, MA), Glutamine synthetase (1:100, Catalog#AB305118, Abcam, Cambridge, MA), Rabbit anti-P2y12 (1:2000, Catalog# 69766, Cell Signaling Technology, Danvers, MA), and Goat Anti-Iba1 (1:500, Catalog# NB100-1028, Novus Biologicals, Centennial, CO).

Secondary antibodies used (1:500, all from ThermoFisher Scientific, Waltham, MA).: Donkey anti-Rabbit 647 (Catalog # A31573), Donkey anti-Rabbit 594 (Catalog # A21207), Donkey anti-Rabbit 488 (Catalog # A21206), Donkey anti-Goat 647 (Catalog # A21447), Donkey anti-Goat 594 (Catalog # A11058), and Donkey anti-Goat 488 (Catalog # A11055).

Cryosectioning

The eyes were enucleated and fixed in 4% PFA for 2 h at room temperature. Following fixation, the anterior chamber was dissected out and the posterior eyecups were cryopreserved for 24 h in 30% sucrose. The eyecups were then embedded in Tissue-Tek® O.C.T compound (Ted Pella, Inc. Redding, CA) and frozen. Retinal sections (12 μm thick) were made using cryostat and used for immunostaining studies.

Imaging and analysis

The retinal sections and flatmounts were imaged using an epifluroscent microscope (Axio Observer Zeiss) or SP8, confocal microscope (Leica). The 3D-reconstruction of acquired Z-stack images were performed using NIH- ImageJ (version:2.1.0/1.53c).

Vascular density: Z-stack images of retinal flatmounts immunostained for CD31 were acquired (covering superficial till deep vascular plexus) using confocal microscopy. The vascular density in the intermediate and deep vascular plexuses were quantified using NIH- ImageJ software (version:2.1.0/1.53c) Angiotool plugin.

Quantifications of microglial cell numbers: Tiled images of retinal flatmounts immunostained for P2ry12 were acquired. Images were then analyzed using the NIH- ImageJ software (version:2.1.0/1.53c) by setting a threshold and quantifying the number of cells (determined by particle size) for each retinal flatmount and plotted.

Statistical analysis

Prism version 9 software was used to perform all statistical analysis and the data were represented as the mean +/- SEM. Unpaired t-test was used to determine statistical differences between experimental groups. In each figure, we noted the level of statistical significance and the sample size of each experimental condition.

Results

Endothelial tip cells interact with Müller cells and microglia during the formation of the inner retinal vascular plexuses

Retinal angiogenesis occurs in phases [1, 2], with the first phase of superficial vascular network formation being mediated by astrocytes [1, 5, 8]. The next phase is the formation of the deep and intermediate vascular networks, which are mediated by Müller cells, ultimately leading to the development of the complex interconnected three layered vascular networks (Fig. 1A) [1, 2, 10]. We recently reported that during the formation of the superficial vascular network, microglia, through complement activation, facilitate the spatial structuring of astrocytes and vascular networks [6]. Here, we sought to determine if microglia interact with Müller cells to facilitate the growth of the deep and intermediate vascular plexuses during the second phase of retinal angiogenesis. We first examined retinal flatmounts for vascular, Müller cell, and microglial interactions during inner retinal angiogenesis (Figs. 1 and 2).

Characterization of retinal flatmounts immunostained for CD31 shows that the inner retinal vascular plexus growth peaks at P10 and completes around P15 (Fig. 1A and B). Müller cells are the most abundant glial cell type of the retina that mature prior to inner retinal vascular plexus formation (Fig. 1C) [13] and drive the growth of the inner retinal vascular development [2, 10]. Examination of P10 retinal cryosections revealed that the endothelial tip cells migrate along Müller cell bodies during the inner retinal vascular developmental process (Fig. 1D). In addition to Müller cells, microglia are also suggested to modulate inner retinal vascular density [15, 16]. We therefore immunostained P10 retinal cryosections and flatmounts for a Müller cell marker (GS), microglial markers (Iba1 and P2ry12), and blood vessel markers (IB4 and CD31) to study microglial-Müller-endothelial interactions during the formation of the inner retinal vascular plexuses (Fig. 2A-B). Data revealed a close association of microglia with the Müller cells and elaborating deep and intermediate vascular plexuses (Fig. 2A-B).

Fig. 1
figure 1

Endothelial cells migrate along Müller cell bodies to develop the inner retinal vascular layers. (A) Representative Z-projection of retinal flatmounts immunostained for CD31 revealing the interconnected superficial, intermediate, and deep vascular plexuses. (B) Retinal flatmounts immunostained for CD31 showing the vascular growth of the intermediate and deep vascular plexuses at P7 (n = 3), P10 (n = 4), and P15 (n = 3). Graph quantifies vessel density age progression in the deep and intermediate vascular plexuses. (C) Graph shows relative mRNA expression of Glul at P7 (n = 4), P10 (n = 4), and P15 (n = 5). (D) Representative P10 retinal cryosection stained for Isolectin B4 (to label blood vessels) and glutamine synthetase (GS) (to label Müller cells). Arrow in the merged image show endothelial tip cell migration over Müller cells. Scale bars: (A) is 20 μm, (B) and (D) are 50 μm

Full size image
Fig. 2
figure 2

Microglia closely interact with endothelial cells and Müller cells during inner retinal vascular development. (A) Representative P10 retinal cryosection immunostained for glutamine synthetase (GS), IsolectinB4 (IB4), and Iba1 revealing microglial association with the growing inner retinal blood vessels and Müller cells, (arrows). (B) Representative P10 retinal flatmount immunostained for P2ry12 and CD31 showing microglial association with the growing intermediate and deep vascular plexuses (n = 4). Bar graph quantifies the number of P2ry12+ cells in the deep and intermediate vascular plexuses at P10 (n = 4). (C) Representative P10 retinal flatmounts from control and PLX5622-treated groups showing microglial (P2ry12) distribution. Bar graph quantifies the number of P2ry12+ cells in the control and microglia depleted (PLX5622) groups and (n = 3). (D) Magnified representative P10 retinal flatmounts from control and PLX5622-treated groups showing microglial (P2ry12) immunostaining (n = 3). Scale bars: (A) is 75 μm, (B) is 50 μm, and (C) is 500 μm

Full size image

Depletion of microglia reduces inner retinal vascular density

We next depleted microglia using a Csf1r antagonist (PLX5622) to study the effect of microglial loss on Müller cells and inner retinal vascular growth (Fig. 2C-D) [6]. Following effective microglial depletion (Fig. 2C-D), we analyzed the CD31 immunostained retinal flatmounts of control and microglia-depleted groups. Results show that the deep and intermediate vascular densities were significantly reduced by over 50% in microglia-depleted retinas in comparison to the control retinas (Fig. 3A-B). Vegfa isoforms play an important role in driving the retinal angiogenesis [24, 25], we therefore determined the expression levels of Vegfa transcripts. Data show that all three Vegfa isoform (120, 164, and 188) transcript levels were significantly decreased in microglia-depleted retinas in comparison to control retinas (Fig. 3C). Müller cells are the key source for Vegfa in the retina that drive inner retinal vascular development and not the microglia [10, 26]. We therefore performed mRNA sequencing on the P10 retinas of control and microglia depleted groups to determine the molecular link between microglial loss and reduced inner retinal vascular density.

Fig. 3
figure 3

Depletion of microglia reduces vascular growth and Vegfa isoform expression levels. P10 control and microglia-depleted retinal flatmounts were immunostained for CD31 to examine deep and intermediate vascular plexus growth (A and B). (A) Retinal flatmounts of control and PLX5622 groups revealing the deep vascular plexus at P10. (B) Intermediate and deep vascular plexuses in the control and PLX5622 groups were imaged and quantified using ImageJ Angio Tool n = 3 (boxed areas in A). (C) RT-PCR was performed to quantify the Vegf120, Vegf164, and Vegf188 isoform levels in the control and PLX5622 retinas at P10 (n = 4). Scale bars: (A) is 200 μm and (B) is 50 μm. All error bars represent ± S.E.M. Statistical differences between control and PLX5622 group were calculated by an unpaired t-test. * P < 0.05, ** P < 0.01

Full size image

Microglial depletion significantly reduced transcript levels of specific Müller cell markers

RNA-seq data further confirms that PLX5622 treatment significantly reduced the transcript levels of generic and signature microglial genes such as P2ry12, Tmem119, and Fcrls (Fig. 4A). In addition, consistent with previous findings, depletion of microglia led to increased expression levels of astrocyte markers such as Pax2, Gfap, Pdgfra (Fig. 4A) [6, 17]. The increased Gfap expression in the retina was restricted to astrocytes (Fig. S1) as reported previously [6]. We did not notice Gfap expression in Müller cells, suggesting that microglial ablation did not induce reactive gliosis in Müller cells (Fig. S1). Intriguingly, we noticed significant downregulation of specific Müller cell markers such as Glul, Kir4.1 (Kcnj10), Kir2.1 (Kcnj2), Aqp4 in microglia-depleted retina (Fig. 4A and Supplementary excel dataset 1) [27]. We then performed pathway analysis on the significantly differentially expressed genes using the Ingenuity Pathway Analysis© tool. The pathway analysis revealed that the genes involved in phagocytosis, complement system, and immune response were significantly downregulated in microglia-depleted retinas compared to control retinas (Fig. 4B). Additionally, pathway analysis revealed a significant downregulation of genes involved in water transport, potassium homeostasis, and glutamine biosynthesis (Fig. 4B and Supplementary excel dataset 2), which are highly expressed by Müller cells [13, 27, 28].

We examined expression levels of other Müller cell markers in our RNA-seq data to determine if microglial depletion altered Müller cell specification or development. Our analysis did not show any significant differential expression of transcription factors such as Sox2 or Vsx2 expressed by Müller cells in microglia-depleted retinas compared to control retinas (Fig. 4C) [29,30,31,32]. Similarly, microglial depletion did not significantly alter the transcript levels of Sox8 and Sox9 transcription factors or its upstream regulator Hes5, which are involved in Müller development (Supplementary excel dataset 1) [33]. We also found no significant changes in the expression levels of other Muller cell markers such as Dkk3, Clu, Rlbp1, Vim, or S100a16 in microglia depleted retinas compared to control retinas (Fig. 4C) [27]. These results suggest that microglia are required for the expression of selective Müller cell specific markers.

The downregulation of the glutamine biosynthetic pathway identified by the pathway analysis tool is of particular significance (Fig. 4B and 5A), because Müller cells are the major source for glutamine in the retina [34] and glutamine is necessary for endothelial proliferation [35, 36]. Particularly in the retina, endothelial specific inhibition of glutamine utilization and catabolism lead to reduced vascular growth [36]. To further validate the RNA-seq results, we measured the transcript levels of Glul, Kir4.1 (Kcnj10), and Aqp4 by qPCR and determined that the genes expression levels were significantly downregulated in microglia depleted retinas compared to control retinas (Fig. 5B). Additionally, immunostaining of P10 retinal sections further confirmed that the depletion of microglia downregulated the intracellular localization of glutamine synthetase in Müller cells compared to control retinas (Fig. 5C). Examination of P15 control and microglia depleted retinas showed that the inner retinal vascular densities and Müller cell expression of glutamate synthetase were decreased in microglia depleted retinas even at vascular growth completion stage (Fig. S2), indicating significant delay in inner retinal angiogenesis. Of note, we did not notice significant differences in the transcript levels of glutamate receptors or transporters in microglia depleted P10 retinas compared to control retinas (Supplementary excel dataset 1).

Thus, our data show that the depletion of microglia led to decreased deep and intermediate vascular plexus densities and diminished expression of specific Müller cell markers, suggesting an important role played by microglia during the second phase of inner retinal angiogenesis.

Fig. 4
figure 4

Microglial depletion significantly reduces Müller cell marker expressions. (A-C) Poly-A captured mRNA sequencing was performed on RNA extracted from the retinas of P10 control and PLX5622 treated groups (n = 4). (A) Heatmap showing differential expression of significantly changed astrocyte, microglial, and Müller cell transcripts. (B) Ingenuity pathway analysis revealing top 15 significantly changed biological pathways in microglia depleted retinas in comparison to control retinas. (C) Table showing list of Müller cell specific transcripts that were not significantly changed in microglia depleted retinas compared to control retinas

Full size image
Fig. 5
figure 5

Microglial depletion results in significant downregulation of glutamine synthetase at P10. (A) Ingenuity pathway analysis showing significant downregulation of Glul gene (green) necessary for glutamine biogenesis and release in the microglia depleted retinas compared to control retinas at P10. (B) RT-PCR data revealing Glul, Kcnj10 (Kir4.1), and Aqp4 transcript expression levels between P10 control and microglia-depleted retinas (n = 4). (C) Representative retinal cryosections showing immunostaining of glutamine synthetase and DAPI (nuclear stain) in control and microglia-depleted groups (n = 3). Scale bar in (C) is 50 μm. All error bars represent ± S.E.M. Statistical differences between control and PLX5622 group were calculated by an unpaired t-test. * P < 0.05 and ** P < 0.01

Full size image

Discussion

Microglia are a dynamic immune cell population of the retina that are distributed in distinct anatomical locations and regulate various developmental processes [6, 7, 15, 37,38,39]. Prior findings showed that the microglia closely associated with the astrocytes in the adjacent ganglion cell layer and eliminate the dying cells during the first postnatal week, thereby facilitating spatially organized astrocyte template formation for the growth of the primary superficial vascular layer. However, the functional relevance of microglia closely interacting with the Müller cells in the inner retina, particularly during deep and intermediate vascular network formation, remains elusive. In this study, we show that the microglia interact with the Müller cell body and the growing deep and intermediate vascular networks. Depletion of microglia led to a significant reduction in inner retinal vascular growth and decreased expression levels of Vegfa isoforms. Further RNA-seq studies revealed that the depletion of microglia resulted in diminished transcript levels of specific Müller cell markers that are necessary for cell maturation and blood vessel-retinal water exchange [40, 41].

Müller cell and microglial interactions were extensively characterized in the context of retinal homeostasis and injury models [42,43,44,45]. The release of extracellular ATP, presumably by Müller cells, is suggested to modulate the morphology and the behavior of resting microglia [42, 44]. Retinal injury models and co-culture systems show that the crosstalk between microglia and Müller cells elicits neurotrophic factor production and provides neuroprotection [43,44,45,46]. Thus, prior investigations clearly reveal the importance of microglial-Müller cell interactions in retinal homeostasis [45]. Recent findings show that microglial-Müller cell intercellular interactions are crucial for removing apoptotic cells during retinal development [18]. The interaction between Müller cells and microglia during inner retinal vascular development is not clearly known. Immunostaining of retinal sections with Müller cell and microglial markers revealed close associations during active inner retinal angiogenesis. Hypoxia experienced in the developing inner retina activates Vegfa expression in Müller cells, which drives endothelial tip cells to migrate into the retina [10]. In addition to growth factor signaling, our data show that Müller cells potentially guide endothelial tip cells into the retina layers, similar to how astrocytes guide endothelial tip cells during superficial vascular development [4, 47].

During the migration of endothelial tip cells into the retinal layers in the second postnatal week in mice, microglia are shown to closely associate and regulate the inner retinal vascular density by suppressing excessive tip cell generation through non-canonical wnt signaling and by modulating Tgf beta signaling [15, 16]. We therefore anticipated that the depletion of microglia would alter endothelial tip cell migratory patterns and/or increase inner retinal vascular density. In contrast to our expectation, microglia-depleted retinas showed decreased densities of deep and intermediate vascular plexuses with a significant reduction in the expression levels of Vegfa isoforms. RNA-seq studies further revealed that the depletion of microglia resulted in significant changes to selective Müller cell maturation markers. We did not see any significant changes in the programmed, pyroptotic, or necrotic pathway genes (Supplementary excel dataset 1) or caspase 3 activation in endothelial cells in the PLX5622 retinas compared to controls (data not shown). This suggests that the reduced inner retinal vascular growth observed in microglia-depleted retinas is not likely due to endothelial cell death and it is likely due to Müller cell specific downregulation of selective genes, in particular glutamine synthetase.

Glutamine metabolism plays an important role in retinal angiogenesis [35, 48]. Deprivation of glutamine impairs endothelial proliferation leading to reduced angiogenesis [35]. Müller cells are the major source of glutamine catabolism in the retina [34]. Our pathway analysis revealed a significant decrease in glutamine biogenesis in microglia depleted retinas compared to control, suggesting that in addition to decreased Vegfa isoform levels, reduction in glutamine synthesis could also contribute to reduced deep and intermediate vascular plexus formation. It is still unclear how the depletion of microglia leads to downregulation of specific Müller cell marker expression such as glul.

There are reports that suggest that the loss of specific cone photoreceptors, rod bipolar cells, and amacrine cells in the aged retinal degenerative (rd1) mouse model could lead to downregulation of glutamine synthetase activity in Müller cells without changes in cell number [49]. Although our RNA-seq studies did not reveal significant changes in the transcript levels of previously reported cell markers [49], there was a significant decrease in bipolar cell markers such as Gpr179, a G-protein-coupled receptor required for mGluR6 signaling cascade in bipolar cells (supplementary excel dataset 1) [50]. There was also significant decrease in Gnat1 (supplementary excel dataset 1), which is required for rods to rod-bipolar cell synaptic transmission and rod-photoreceptor survival [51]. It is possible that the changes in bipolar and rod photoreceptor synaptic activity could contribute to downregulation of glul in Müller cells. Rod photoreceptors, Müller cells, and bipolar cells, originate from common progenitor cells [52]. Therefore, it is also possible that microglia directly or indirectly regulate expressions of certain genes in the common retinal progenitors during tissue maturation. Further studies are required to investigate if these developmental changes continue to persist in the adult retinas.

In addition, Kir4.1 expressed by Müller cells is also suggested to facilitate glutamate transport and help maintain water balance through aquaporin channels in the retina [28, 53, 54]. Although it is unclear how the depletion of microglia leads to Kir4.1 downregulation in Müller cells, we cannot rule out the possibility that decrease in Kir4.1 could also attribute to reduced glul and aqp4 levels.

Taken together, our data strongly implicates that microglia play an important role in facilitating Müller cell maturation, which is required for inner retinal vascular development. Microglia depletion leads to significant reduction in selective Müller cell maturation markers and inner retinal vascular density.

Data availability

All the images and data are available at the institutional repository (https://dataverse.harvard.edu/dataverse/tufts). The RNA-seq data has been uploaded to the GEO database repository (accession # GSE274107). All the uploaded data will be made public upon acceptance and the data will also be available by reaching out to the corresponding author.

References

  1. Fruttiger M. Development of the retinal vasculature. Angiogenesis. 2007;10(2):77–88.

    Article  PubMed  Google Scholar 

  2. Stone J, Itin A, Alon T, Pe’er J, Gnessin H, Chan-Ling T, Keshet E. Development of retinal vasculature is mediated by hypoxia-induced vascular endothelial growth factor (VEGF) expression by neuroglia. J Neurosci. 1995;15(7 Pt 1):4738–47.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Uemura A, Kusuhara S, Katsuta H, Nishikawa S. Angiogenesis in the mouse retina: a model system for experimental manipulation. Exp Cell Res. 2006;312(5):676–83.

    Article  CAS  PubMed  Google Scholar 

  4. Gerhardt H, Golding M, Fruttiger M, Ruhrberg C, Lundkvist A, Abramsson A, Jeltsch M, Mitchell C, Alitalo K, Shima D, et al. VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia. J Cell Biol. 2003;161(6):1163–77.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Gnanaguru G, Bachay G, Biswas S, Pinzon-Duarte G, Hunter DD, Brunken WJ. Laminins containing the beta2 and gamma3 chains regulate astrocyte migration and angiogenesis in the retina. Development. 2013;140(9):2050–60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Gnanaguru G, Tabor SJ, Bonilla GM, Sadreyev R, Yuda K, Kohl J, Connor KM. Microglia refine developing retinal astrocytic and vascular networks through the complement C3/C3aR axis. Development 2023, 150(5).

  7. Rymo SF, Gerhardt H, Wolfhagen Sand F, Lang R, Uv A, Betsholtz C. A two-way communication between microglial cells and angiogenic sprouts regulates angiogenesis in aortic ring cultures. PLoS ONE. 2011;6(1):e15846.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Fruttiger M, Calver AR, Kruger WH, Mudhar HS, Michalovich D, Takakura N, Nishikawa S, Richardson WD. PDGF mediates a neuron-astrocyte interaction in the developing retina. Neuron. 1996;17(6):1117–31.

    Article  CAS  PubMed  Google Scholar 

  9. Tao C, Zhang X. Retinal proteoglycans Act as Cellular receptors for Basement Membrane Assembly to Control Astrocyte Migration and Angiogenesis. Cell Rep. 2016;17(7):1832–44.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Rattner A, Williams J, Nathans J. Roles of HIFs and VEGF in angiogenesis in the retina and brain. J Clin Invest. 2019;129(9):3807–20.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Zarkada G, Howard JP, Xiao X, Park H, Bizou M, Leclerc S, Kunzel SE, Boisseau B, Li J, Cagnone G, et al. Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation. Dev Cell. 2021;56(15):2237–e22512236.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Gnanaguru G, Brunken WJ. The cell-matrix interface: a possible target for treating retinal vascular related pathologies. J Ophthalmic Vis Res. 2012;7(4):316–27.

    PubMed  PubMed Central  Google Scholar 

  13. Wang J, O’Sullivan ML, Mukherjee D, Punal VM, Farsiu S, Kay JN. Anatomy and spatial organization of Muller glia in mouse retina. J Comp Neurol. 2017;525(8):1759–77.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Shen W, Fruttiger M, Zhu L, Chung SH, Barnett NL, Kirk JK, Lee S, Coorey NJ, Killingsworth M, Sherman LS, et al. Conditional mullercell ablation causes independent neuronal and vascular pathologies in a novel transgenic model. J Neurosci. 2012;32(45):15715–27.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Dudiki T, Meller J, Mahajan G, Liu H, Zhevlakova I, Stefl S, Witherow C, Podrez E, Kothapalli CR, Byzova TV. Microglia control vascular architecture via a TGFbeta1 dependent paracrine mechanism linked to tissue mechanics. Nat Commun. 2020;11(1):986.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Stefater JA 3rd, Lewkowich I, Rao S, Mariggi G, Carpenter AC, Burr AR, Fan J, Ajima R, Molkentin JD, Williams BO, et al. Regulation of angiogenesis by a non-canonical Wnt-Flt1 pathway in myeloid cells. Nature. 2011;474(7352):511–5.

  17. Punal VM, Paisley CE, Brecha FS, Lee MA, Perelli RM, Wang J, O’Koren EG, Ackley CR, Saban DR, Reese BE, et al. Large-scale death of retinal astrocytes during normal development is non-apoptotic and implemented by microglia. PLoS Biol. 2019;17(10):e3000492.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Morales M, Findley AP, Mitchell DM. Intercellular contact and cargo transfer between Muller glia and to microglia precede apoptotic cell clearance in the developing retina. Development 2024, 151(1).

  19. Tabor SJ, Yuda K, Deck J, Gnanaguru G, Connor KM. Retinal Injury activates complement expression in Muller cells leading to Neuroinflammation and photoreceptor cell death. Cells 2023, 12(13).

  20. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21.

    Article  CAS  PubMed  Google Scholar 

  21. Anders S, Pyl PT, Huber W. HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics. 2014;31(2):166–9.

    Article  PubMed  PubMed Central  Google Scholar 

  22. McCarthy DJ, Chen Y, Smyth GK. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 2012;40(10):4288–97.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Kolde R. pheatmap: Pretty Heatmaps. R package version 1.0. 12. R Packag version 10 2019, 8.

  24. Ng YS, Rohan R, Sunday ME, Demello DE, D’Amore PA. Differential expression of VEGF isoforms in mouse during development and in the adult. Dev Dyn. 2001;220(2):112–21.

    Article  CAS  PubMed  Google Scholar 

  25. Stalmans I, Ng YS, Rohan R, Fruttiger M, Bouche A, Yuce A, Fujisawa H, Hermans B, Shani M, Jansen S, et al. Arteriolar and venular patterning in retinas of mice selectively expressing VEGF isoforms. J Clin Invest. 2002;109(3):327–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Saint-Geniez M, Maharaj AS, Walshe TE, Tucker BA, Sekiyama E, Kurihara T, Darland DC, Young MJ, D’Amore PA. Endogenous VEGF is required for visual function: evidence for a survival role on muller cells and photoreceptors. PLoS ONE. 2008;3(11):e3554.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Roesch K, Jadhav AP, Trimarchi JM, Stadler MB, Roska B, Sun BB, Cepko CL. The transcriptome of retinal Muller glial cells. J Comp Neurol. 2008;509(2):225–38.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Hirrlinger PG, Pannicke T, Winkler U, Claudepierre T, Varshney S, Schulze C, Reichenbach A, Brunken WJ, Hirrlinger J. Genetic deletion of laminin isoforms beta2 and gamma3 induces a reduction in Kir4.1 and aquaporin-4 expression and function in the retina. PLoS ONE. 2011;6(1):e16106.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Bachleda AR, Pevny LH, Weiss ER. Sox2-Deficient Muller Glia disrupt the structural and functional maturation of the mammalian retina. Invest Ophthalmol Vis Sci. 2016;57(3):1488–99.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Gorsuch RA, Lahne M, Yarka CE, Petravick ME, Li J, Hyde DR. Sox2 regulates Muller glia reprogramming and proliferation in the regenerating zebrafish retina via Lin28 and Ascl1a. Exp Eye Res. 2017;161:174–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Surzenko N, Crowl T, Bachleda A, Langer L, Pevny L. SOX2 maintains the quiescent progenitor cell state of postnatal retinal Muller glia. Development. 2013;140(7):1445–56.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Honnell V, Norrie JL, Patel AG, Ramirez C, Zhang J, Lai YH, Wan S, Dyer MA. Identification of a modular super-enhancer in murine retinal development. Nat Commun. 2022;13(1):253.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Muto A, Iida A, Satoh S, Watanabe S. The group E sox genes Sox8 and Sox9 are regulated by notch signaling and are required for Muller glial cell development in mouse retina. Exp Eye Res. 2009;89(4):549–58.

    Article  CAS  PubMed  Google Scholar 

  34. Singh C, Tran V, McCollum L, Bolok Y, Allan K, Yuan A, Hoppe G, Brunengraber H, Sears JE. Hyperoxia induces glutamine-fuelled anaplerosis in retinal muller cells. Nat Commun. 2020;11(1):1277.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Huang H, Vandekeere S, Kalucka J, Bierhansl L, Zecchin A, Bruning U, Visnagri A, Yuldasheva N, Goveia J, Cruys B, et al. Role of glutamine and interlinked asparagine metabolism in vessel formation. EMBO J. 2017;36(16):2334–52.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Kim B, Li J, Jang C, Arany Z. Glutamine fuels proliferation but not migration of endothelial cells. EMBO J. 2017;36(16):2321–33.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Anderson SR, Zhang J, Steele MR, Romero CO, Kautzman AG, Schafer DP, Vetter ML. Complement targets newborn retinal ganglion cells for phagocytic elimination by Microglia. J Neurosci. 2019;39(11):2025–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Fantin A, Vieira JM, Gestri G, Denti L, Schwarz Q, Prykhozhij S, Peri F, Wilson SW, Ruhrberg C. Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction. Blood. 2010;116(5):829–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Schafer DP, Lehrman EK, Kautzman AG, Koyama R, Mardinly AR, Yamasaki R, Ransohoff RM, Greenberg ME, Barres BA, Stevens B. Microglia sculpt postnatal neural circuits in an activity and complement-dependent manner. Neuron. 2012;74(4):691–705.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Nicchia GP, Pisani F, Simone L, Cibelli A, Mola MG, Dal Monte M, Frigeri A, Bagnoli P, Svelto M. Glio-vascular modifications caused by Aquaporin-4 deletion in the mouse retina. Exp Eye Res. 2016;146:259–68.

    Article  CAS  PubMed  Google Scholar 

  41. Pannicke T, Wurm A, Iandiev I, Hollborn M, Linnertz R, Binder DK, Kohen L, Wiedemann P, Steinhauser C, Reichenbach A, et al. Deletion of aquaporin-4 renders retinal glial cells more susceptible to osmotic stress. J Neurosci Res. 2010;88(13):2877–88.

    Article  CAS  PubMed  Google Scholar 

  42. Fontainhas AM, Wang M, Liang KJ, Chen S, Mettu P, Damani M, Fariss RN, Li W, Wong WT. Microglial morphology and dynamic behavior is regulated by ionotropic glutamatergic and GABAergic neurotransmission. PLoS ONE. 2011;6(1):e15973.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Harada T, Harada C, Kohsaka S, Wada E, Yoshida K, Ohno S, Mamada H, Tanaka K, Parada LF, Wada K. Microglia-Muller glia cell interactions control neurotrophic factor production during light-induced retinal degeneration. J Neurosci. 2002;22(21):9228–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Wang M, Ma W, Zhao L, Fariss RN, Wong WT. Adaptive Muller cell responses to microglial activation mediate neuroprotection and coordinate inflammation in the retina. J Neuroinflammation. 2011;8:173.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Wang M, Wong WT. Microglia-Muller cell interactions in the retina. Adv Exp Med Biol. 2014;801:333–8.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Abbott NJ, Ronnback L, Hansson E. Astrocyte-endothelial interactions at the blood-brain barrier. Nat Rev Neurosci. 2006;7(1):41–53.

    Article  CAS  PubMed  Google Scholar 

  47. Dorrell MI, Aguilar E, Friedlander M. Retinal vascular development is mediated by endothelial filopodia, a preexisting astrocytic template and specific R-cadherin adhesion. Invest Ophthalmol Vis Sci. 2002;43(11):3500–10.

    PubMed  Google Scholar 

  48. Wang Z, Yemanyi F, Blomfield AK, Bora K, Huang S, Liu CH, Britton WR, Cho SS, Tomita Y, Fu Z et al. Amino acid transporter SLC38A5 regulates developmental and pathological retinal angiogenesis. Elife 2022, 11.

  49. Reynisson H, Kalloniatis M, Fletcher EL, Shivdasani MN, Nivison-Smith L. Loss of Muller cell glutamine synthetase immunoreactivity is associated with neuronal changes in late-stage retinal degeneration. Front Neuroanat. 2023;17:997722.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Ray TA, Heath KM, Hasan N, Noel JM, Samuels IS, Martemyanov KA, Peachey NS, McCall MA, Gregg RG. GPR179 is required for high sensitivity of the mGluR6 signaling cascade in depolarizing bipolar cells. J Neurosci. 2014;34(18):6334–43.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Majumder A, Pahlberg J, Boyd KK, Kerov V, Kolandaivelu S, Ramamurthy V, Sampath AP, Artemyev NO. Transducin translocation contributes to rod survival and enhances synaptic transmission from rods to rod bipolar cells. Proc Natl Acad Sci U S A. 2013;110(30):12468–73.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Boccuni I, Fairless R. Retinal glutamate neurotransmission: from physiology to pathophysiological mechanisms of retinal ganglion cell degeneration. Life (Basel) 2022, 12(5).

  53. Ishii M, Horio Y, Tada Y, Hibino H, Inanobe A, Ito M, Yamada M, Gotow T, Uchiyama Y, Kurachi Y. Expression and clustered distribution of an inwardly rectifying potassium channel, KAB-2/Kir4.1, on mammalian retinal Muller cell membrane: their regulation by insulin and laminin signals. J Neurosci. 1997;17(20):7725–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Li X, Lv J, Li J, Ren X. Kir4.1 may represent a novel therapeutic target for diabetic retinopathy (review). Exp Ther Med. 2021;22(3):1021.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We thank Plexxikon, inc, for providing PLX5622 chow diet. We thank MGH Nextgen sequencing core staff Danning Zhou and Ulandt Kim for the help with cDNA library construction and sequencing.

Funding

This study was supported by NIH/National Eye Institute Grant R01EY032502, R01EY036414 (to G.G), R21EY033046 (to CS), and NIH/NIDDK P30 DK040561 (to R.I.S).

Author information

Authors and Affiliations

  1. Department of Ophthalmology, Tufts University School of Medicine, Tufts Medical Center, Boston, MA, 02111, USA

    Nathaniel Rowthorn-Apel, Charandeep Singh & Gopalan Gnanaguru

  2. Department of Ophthalmology, University of North Carolina, Chapel Hill, NC, 27599, USA

    Naveen Vridhachalam

  3. Angiogenesis Laboratory, Department of Ophthalmology, Massachusetts Eye and Ear Infirmary, Harvard Medical School, Boston, MA, 02114, USA

    Kip M. Connor

  4. Department of Molecular Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA, 02114, USA

    Gracia M. Bonilla & Ruslan Sadreyev

  5. Department of Pathology, Massachusetts General Hospital, Harvard Medical School, Boston, MA, 02114, USA

    Ruslan Sadreyev

  6. Vice President of Retinal Strategy, Johnson & Johnson Innovation Center, Cambridge, MA, 02142, USA

    Gopalan Gnanaguru

Authors
  1. Nathaniel Rowthorn-Apel
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Naveen Vridhachalam
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Kip M. Connor
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Gracia M. Bonilla
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Ruslan Sadreyev
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Charandeep Singh
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Gopalan Gnanaguru
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

GG conceptualized, directed the study, and wrote the manuscript. KMC provided the resources and involved in experimental design. NR and NV performed the experiments and involved in manuscript writing. RS and GMB assisted with RNA-seq studies, and CS helped with data analysis and manuscript preparation.

Corresponding author

Correspondence to Gopalan Gnanaguru.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Rowthorn-Apel, N., Vridhachalam, N., Connor, K.M. et al. Microglial depletion decreases Müller cell maturation and inner retinal vascular density. Cell Commun Signal 23, 90 (2025). https://doi.org/10.1186/s12964-025-02083-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12964-025-02083-5

Keywords

Cell Communication and Signaling

ISSN: 1478-811X