Skip to main content
Download PDF

Dust mite antigens endow dendritic cells with the capacity to induce a Th2 response by regulating their methylation profiles

Cell Communication and Signaling volume 22, Article number: 606 (2024) Cite this article

Abstract

Background

It is well-known that Dendritic cells (DCs) are essential in the development of airway Th2 polarization and airway allergy (AA). The underlying mechanism is still not fully understood. The objective of this study is to examine the role of methyltransferase-like protein-5 (Mettl5), a methyltransferase involved in N6-methyladenosine (m6A) methylation, in altering DC’s properties to facilitate the development of Th2 polarization and AA.

Methods

Dust mite extracts (DME) were used as a specific antigen to establish an AA mouse model. The epigenetic status of DCs was examined using a Chromatin immunoprecipitation (ChIP) assay. A mouse strain carrying the Mettl5-deficient DCs was used to observe the role of Mettl5 in determining the phenotypes of DCs.

Results

The results showed that the expression of Mettl5 was elevated in DCs, which was positively correlated with the AA response. The development of airway Th2 polarization was hindered by Mettl5 depletion in DCs. Mettl5 is involved in the transcription of the Timd4 gene in DCs caused by DME. The degradation of IRF5 by Mettl5 led to an increase in T cell immunoglobulin domain molecule-4 (TIM4) expression in DCs associated with DME. Inhibition of Mettl5 in DCs reconciled the DME-induced airway Th2 polarization and experimental AA.

Conclusions

Airway DCs from AA mice showed elevated amounts of Mettl5, which led to the expression of TIM4. The experimental AA was mitigated by Mettl5 inhibition.

Graphical abstract

Introduction

Dendritic cells (DCs) are a fraction of immune cells, which are the professional antigen presenting cells. Once entering the body, antigens are captured by DCs. DCs then process the antigens, and present the antigen information and relevant cytokines to CD4+ T cells [1]. Cytokines presented to CD4+ T cells by DCs play a crucial role in determining the types of immune responses, namely, T helper 1 (Th1) or Th2 response [2]. DC-derived interleukin-12 (IL-12) induces a Th1 response, in which interferon regulatory factor-5 (IRF5) plays a critical role [3], while DC-derived TIM4 (T cell immunoglobulin domain molecule-4) induces a Th2 response [4, 5]. There is still a lot to be learned about the factors that determine DCs’ ability to produce TIM4. It is recognized that the epigenetic status determines the gene transcription. For example, the hypermethylation of a promoter reduces or inhibits the gene transcription. Gene transcription occurs when the promoter is at a status of hypomethylation [6]. The epigenetic status that favors the transcription of TIM4 in DCs remains to be characterized.

Published data indicate that the status of the N6-methyladenosine (m6A) methylation is associated with the pathogenesis of airway allergy (AA) [7, 8]. methyltransferase-like protein-3 (Mettl3) and Mettl14 are the major methyltransferases of m6A [9]. Mettl5 is an additional methylase for m6A methylation. Specifically, Mettl5 is capable of inducing pro inflammatory cell infiltration [10], which is a key feature of AA. The above information suggests that Mettl5 may be associated with the pathogenesis of AA. In this study, we observed elevated amounts of Mettl5 in airway DCs, which are positively associated with the development of the TIM4-producing DCs, and the AA response. Inhibition of Mettl5 reduced the expression of TIM4 in DCs, and attenuated experimental AA.

Materials and methods

Reagents

JAWSII cells (a cell line of dendritic cell) were purchased from ATCC (CRL-3612). Dust mite extract protein (Huaren Medical Inc. Shenzhen, China). ELISA kits of EPX (Kemiao Biotech, Wenzhou, China), Mcpt1 (MultiSciences, Hangzhou, China), Mite-specific IgE, m6A, IRF5, STAT6, Trim24, K48, proteasome (AmyJet Biotech, Wuhan, China), IL-10, IL-12, TGF-β, IL-4, IL-5 and IL-13 (Balb.Biomart, Beijing, China), TIM4 (Pujian Biotech, Wuhan, China), Pol II (Juebo Biotech, Shanghai, China), ubiquitin (Zeye Biotech, Shanghai, China), histone H3, H3K4me3, H3K9me3, and H3K27me3 (Beinou Biotech, Shanghai, China). Antibodies (Abs) of CD11c (sc-23951, AF488), MHC II (sc-32247, AF546), B220 (sc-70712, AF594), CD3 (sc-20047, AF488), CD4 (sc-19641, AF546), CD25 (sc-393326, AF594), IL-4 (sc-53084, AF648), IL-5 (sc-398334, AF680), IL-13 (sc-393365, AF790), and CD62L (sc-13505, AF648) were purchased from Santa Cruz Biotech (Santa Cruz, CA). MBS5300577 Mettl5 Ab was bought from MyBioSource in San Diego, CA. Thermo Fisher Scientific (Waltham, MA) provided the reagents and materials for RT-qPCR, IP, and ChIP.

Mice

BALB/c mice were provided by Guangdong Experimental Animal Center (Fushan, China). Mettl5f/f mice and Itgax-Cre mice were bought from Jackson Laboratory (Bar Harbor, ME). The Mettl5f/fItgax-Cre mice were generated in-house by crossing Mettl5f/f mice with Itgax-Cre mice. The use of mice in this study was approved by the animal ethics committee at our university (A202300068). The guidelines of ARRIVAL were followed in the conduct of all animal experiments.

An airway allergy (AA) mouse model

Following published procedures [11, 12], randomly grouped mice were sensitized to dust mite antigen by subcutaneously injecting with dust mite extracts (DME; 0.1 mg/mouse mixed with 0.2 mg alum) on day 1 and day 7, respectively. Between day 9 and day 22, mice were given nasal instillations (20 µL per nostril containing 5 mg DME/mL) every day. On day 23, mice were challenged with a large dose of DME (20 µL/nostril containing 50 mg DME/mL). The AA response was evaluated afterwards.

Evaluation of AA response

Referring to established procedures [11, 12], the AA response was evaluated. It includes cell infiltration of the airways, quantities of antigen-specific IgE (sIgE), eosinophil peroxidase (EPX), mouse mast cell protease-1 (Mcpt1), IL-4, IL-5, and IL-13 as well as IL-10, IL-12 and TGF-β in bronchoalveolar lavage fluid (BALF). To collect BALF, the trachea was exposed in the neck immediately after the sacrifice. A syringe was used to inject one milliliter of saline into the lungs through the trachea. The fluid was recovered immediately with the same syringe. The lavage procedures were repeated two more times. The fluids from three lavages were pooled and used as BALF in further experiments. The pellets were resuspended in PBS; the total cell number in BALF was counted using a hemocytometer. A portion of the cell suspensions was smeared on a slide and stained with Giemsa. The number of eosinophils, neutrophils, lymphocytes and monocytes were counted under a light microscope. Quantities of sIgE and cytokines in BALF were determined using enzyme-linked immunosorbent assay (ELISA).

Histology of the lung tissues

A piece of the lung tissues was excised from mice upon the sacrifice, fixed in 4% formalin overnight, and processed for paraffin sections. The sections were stained with hematoxylin and eosin, and observed under a light microscope. Twenty images were randomly taken from each group at a magnification of ×100.

Airway resistance measurement

One day after the last challenge, mice were anesthetized with an i.p. injection of a solution of xylazine and ketamine in sterile saline at a dose of 80 µg and ketamine 16 µg xylazine/g body weight. Then, mice were tracheostomized, intubated, and placed in the chamber with an intubation that connected the ventilator (DSI Buxco Electronics, Troy, NY). To evaluate airway hyperresponsiveness, mice were inhaled methacholine (Sigma-Aldrich) at escalating doses of 0, 6.25, 12.5, 25, and 50 mg/ml.

ELISA and cross-ELISA

The quantities of cytokines, sIgE in BALF or culture supernatant, and proteins of cellular extracts were determined by ELISA using specific reagent kits, according to the protocols provided by the manufacturers. The procedures for cross-ELISA are the same as regular ELISA, except that the plates were coated with Ab1, and Ab2 was used as the detection Ab. Cross-ELISA was utilized to quantitatively detect protein complexes that consist of two or more protein molecules.

Airway tissue single cell preparation

Following published procedures [11, 12], the lungs were excised from mice upon the sacrifice. The tissues were cut into small pieces, and incubated with collagenase IV (0.5 mg/mL) and DNase I (0.2 mg/mL) at 37 °C for 30 min with mild agitation. Single cells were filtered through a cell strainer, and used in other experiments.

Cell culture

Cell culture was conducted using RPMI1640 medium. The medium was supplemented with antibiotics (penicillin and streptomycin), L-glutamine, and fetal calf serum. The Trypan blue exclusion assay was utilized to measure cell viability, and it was between 97 and 99% in the cells tested in this study.

Flow cytometry

Following published procedures [11, 12], single cells (106 cells per sample) were stained with fluorescence labeled Abs (detailed in figures) or isotype IgG through the surface staining or/and intracellular staining. Cells were analyzed using a BD FACSCanto II flow cytometer. The results were processed using a software package (Flowjo, v10, TreeStar Inc., Ashland, OR) with the data obtained from isotype IgG staining as a gating reference.

Purification of immune cells

Airway single cells were stained with fluorescence-labelled Abs of CD11c and major histocompatibility complex II (MHC II). CD11c+MHC II+ cells were sorted using a BD Aria flow cytometer, and used as DCs in other experiments. Spleen cells were prepared from naive mice. The cells were stained with fluorescence-labelled Abs of CD3, CD4, and CD62L. With flow cytometry, CD3+ cells were gated, from which CD4+CD62L+ cells were sorted, and used as naive CD4+ T cells in other experiments. Cell purity was checked by flow cytometry. If the purity did not exceed 90%, the purification procedures were repeated.

Chromatin immunoprecipitation (ChIP)

Referring to the experimental procedures of previous studies [11, 13], DCs were collected from relevant experiments, fixed in 1% formalin for 15 min to cross-link the DNA and the surrounding proteins. The cells were lysed in a RIPA buffer and then subjected to sonication to break apart the DNA into small pieces. A portion of the supernatant was put aside to be the input. The pre-existing immune complexes were cleared by incubating with protein A/G beads for 2 h. After centrifugation, the beads were discarded. The samples were incubated with relevant Abs (detailed in figures) or isotype IgG overnight. Protein A/G beads were used to adsorb immune complexes in samples. The beads were collected by centrifugation. DNA and proteins were extracted from the ChIP products, and analyzed by qPCR and ELISA, respectively. The primers used in ChIP-qPCR are Trim24 (ggctttttacgcagcttttg and ggatggtcccttatccaggt) and Irf5 (gagccaggaaaatcgtttga and aaccctgtcttgcatggttc). The results of ChIP are presented as fold changes against the input. All the procedures were performed at 4 °C.

Real-time quantitative RT-PCR (RT-qPCR)

Following published procedures [11, 13], RNA was extracted from cells and converted into cDNA using a reverse transcription kit (Qiagen) following the protocol provided by the manufacturer. The cDNA samples were amplified in a Bio Rad CFX96 qPCR device using the SYBR Green Master Mix. The primers used in the present study include Mettl5 (attgaaaacaaagcggttgc and gtcccaaagggaggattcat), Mrc1 (atgccaagtgggaaaatctg and tgtagcagtggcctgcatag), Timd4 (acaccaccccagacactagc and gtcgtcagctgtgaagtgga), and Irf5 (caggtgaacagctgccagta and ctcatccaccccttcagtgt). The results were calculated using the formula of 2−ΔΔCt method and presented as fold changes against the housekeeping gene Actb (agccatgtacgtagccatcc and ctctcagctgtggtggtgaa).

Assessment of RNA m6A methylation

Following the protocol provided by the manufacturer of the reagent kit, the total RNA was analyzed with an m6A RNA methylation assay kit (ab185912, abcam, Cambridge, MA) to determine its m6A content. The capture antibody, detection antibody, and enhancer solution were used to react with the negative control, positive control, and RNA samples after mixing with the binding solution. When the positive control color turned to medium blue, the reaction was terminated using the color developing solution. A microplate reader (SpectraMax ABS) was used to measure the absorbance value at a wavelength of 450 nm. The data were presented as a percentage of the total RNA.

Methylation specific qPCR

As reported previously [14], purified airway Tr1 cells were collected from experiments, and DNA samples were extracted using an Invitrogen Universal Genomic DNA Extraction Kit. The samples were processed by utilizing the bisulfide reagent kit (EpiJET; ThermoFisher) according to the manufacturer’s protocol. The samples were analyzed using qPCR. The primers of the Irf5 promoter used in the experiments included a pair of methylated primers (tggtttagggtagtttttggttaag and ctctaaataaatccaatcacaataac) and a pair of unmethylated primers (ttatattattggtgggggagttatc and ccctaaactcctatacactatcacga), and Timd4 promoter methylated primers (agatttttaaagaattagagaataattttg and ttaatacaacaaaacaaaaaaaccc), Timd4 promoter unmethylated primers (tagatgtgtaatttgaatagatatttcga and taacttaaaaaactacaacaccgaa). The percentage of Il10 promoter methylation was presented as the result.

Knockdown of the Mrc1 gene in JAWSII cells using RNA interference (RNAi)

Following the protocol provided by the manufacturer, the Mrc1 gene was knocked down in JAWSII cells using a reagent kit (Santa Cruz). The RNAi effect was checked in the cells by RT-qPCR two days after.

Assessment of DC apoptosis

Airway single cells were prepared as described above, and stained with fluorescence labeled anti-CD11c ab and the reagent of annexin V kit following the manufacturer’s instruction. The cells were then analyzed using a flow cytometer.

Statistical analysis

Student’s t-test was used to determine the difference between two groups. ANOVA followed by Tukey HSD post hoc test was performed for multiple comparisons. The correlation between two datasets was determined by conducting a Pearson correlation coefficient test. p < 0.0.5 was the significant criterion.

Results

Expression of Mettl5 in DCs is positively correlated with the AA response

An airway allergy (AA) mouse model was established with DME as a specific antigen (Fig. 1A). The mice showed the AA response, including a profound cell infiltration, elevated amounts of mite specific IgE, eosinophil peroxidase (EPX), mouse mast cell protease-1 (Mcpt1), IL-4, IL-5, and IL-13 in the bronchoalveolar lavage fluid (BALF). AA mice had lower amounts of IL-10 and IL-12 in their BALF than NC mice. The TGF-β quantity in BALF were comparable between the naïve control (NC) group and the AA group (Fig. 1B-L). AA mice showed hyperresponsiveness in response to the challenge with methacholine (Fig. 1M). As Mettl5 has a significant impact on immune cell infiltration [15], and DCs are the cells that initiate an immune response [16], we investigated the expression of Mettl5 in airway DCs. Airway DCs (CD11c+MHC II+) were isolated by flow cytometry cell sorting. The cellular extracts were prepared from the cells, and analyzed by RT-qPCR and ELISA. Elevated amounts of Mettl5 were detected in airway DCs of AA mice, while the amounts of Mettl3 and Mettl14 in DCs were not significantly altered by the sensitization (Fig. 1N-S). A positive correlation was detected between the expression of Mettl5 in DCs and the parameters of the AA response. A negative correlation was detected between DC-derived Mettl5 and IL-12/IL-10 (Fig. 1T). The findings implicate that the expression of Mettl5 may be involved in the pathogenesis of AA.

Fig. 1
figure 1

Assessment of the relationship between the expression of Mettl5 in airway DCs and the AA response. A, a schematic of establishing an AA mouse model. B-C, total cell counts and differential cell types in BALF. D-L, bars show the amounts of indicated molecules in BALF. M, airway resistance changes in response to methacholine challenge. N-S, quantities of mRNA and protein of indicated molecules in airway DCs. T, a heatmap shows the coefficients between the indicated items. The data of bars are presented as mean ± SD. Each bubble in bars presents one sample (assessed in triplicate). Statistics: Student’s t-test (the bar graphs) and Pearson correlation coefficient test (the heatmap). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns: Not significant. Each group consists of 6 mice. NC: Naïve control. AA: Airway allergy. BALF: Bronchoalveolar lavage fluid. DC: Dendritic cell. Resistance: Airway resistance changes

Full size image

The expression of Mettl5 in airway DCs is associated with the development of airway Th2 polarization

Next, we examined the role of Mettl5 expression in DCs and its contribution to the development of airway Th2 polarization. Mice were treated with nasal instillation (containing DME) daily for 5 days. Th2 polarization was detected in mice with elevated amounts of Th2 cytokines in BALF. Conditional ablation of the Mettl5 gene in DCs (using the Mettl5f/fItgax-Cre mice) abolished the development of Th2 polarization in mice (Fig. 2A-G). Since DME was used as a specific antigen to establish the AA mouse model, we inferred that the exposure to DME induced DCs to express Mettl5. To test the inference, naive DCs (B220+CD11c+MHC II+) were stimulated with DME in culture at gradient concentrations. The results showed that exposure to DME induced DCs to express Mettl5 in a dose-dependent manner (Fig. 2H-I). The Mettl5-producing DCs (m5DCs) were prepared using this model (Fig. 2J). The m5DCs were cocultured with naive CD4+ T cells in the presence of IL-2 for three days. We found that m5DCs efficiently induced the naive CD4+ T cells to differentiate into Th2 cells. PBS-treated DCs did not show the ability to induce Th2 cells (Fig. 2K-Q). The results demonstrate that Mettl5-producing DCs are capable of inducing Th2 cell development.

Fig. 2
figure 2

DME-primed DCs induce Th2 cell development. BALF and single cells were isolated from the lungs of mice, which were treated with nasal instillations containing DME or PBS for 5 days. A-C, bars show the quantities of Th2 cytokines in BALF. D-G, single cells were analyzed using flow cytometry. D, adhesive cells were gated out. E, CD3+CD4+ T cells were gated, from which Th2 cells were gated (F). G, bars show the counts of Th2 cells in F. H-I, lines show Mettl5 mRNA (H) or Mettl5 protein in DCs after exposure of them to DME in culture for 2 days. J, preparing Mettl5-expressing DCs (by exposing to DME or PBS in culture for 2 days). K-O, the DME (or PBS)-pulsed DCs were cultured with naïve CD4+ T cells for 3 days. Cells were analyzed using flow cytometry. K, CD4+ T cells were gated, from which the induced Th2 cells were gated (L-Q, the gated flow cytometry plots show Th2 cells; the bars show the counts of Th2 cells). The data of bars are presented as mean ± SD. Each bubble in bars presents one sample (assessed in triplicate). Statistics: ANOVA + Tukey HSD test (A-C, G) and Student’s t-test (M, O, Q). *p < 0.05; **p < 0.01; ***p < 0.001. KO: Mettl5f/fItgax-Cre mice. cKO: Mettl5f/f mice. Each group consists of 6 mice. DME: Dust mite extracts

Full size image

Mannose receptor-1 (MRC1) mediates the effects of DME on inducing DCs to express Mettl5

Previous studies indicate that MRC1 mediates the absorption of Der P1 and Der P2 (the two major antigen proteins of dust mites) in DCs [17]. Prompted by this, we inferred that MRC1 mediated the effects of DME on inducing the expression of Mettl5 in DCs. The inference was tested by administering DME-containing nasal instillations daily for five days in mice. Airway DCs were isolated from the mice, and analyzed by RT-qPCR and ELISA. We found that elevated amounts of Mettl5 in DCs isolated from mice treated with DME-containing nasal instillations. Conditional ablation of the Mrc1 gene (using the Mrc1f/fItgax-Cre mice) abolished the induction of Mettl5 in airway DCs (Fig. 3A-B). Alternatively, JAWSII cells (a mouse DC cell line) were exposed to DME in culture for two days. This increased the expression of Mettl5 in JAWSII cells (Fig. 3C-D). Knockdown of the Mrc1 gene by RNAi (Fig. 3E) blocked the DME-induced Mettl5 expression in JAWSII cells (Fig. 3C-D). Additionally, the amounts of total m6A and methylated m6A in airway DCs were not significantly different between the NC mice and AA mice (Fig. 3F-G). The results demonstrate that MRC1 mediates the effects of DME on inducing DCs to express Mettl5.

Fig. 3
figure 3

Assessment of the role of MRC1 in mediating the effects of DME on inducing Mettl5 expression in DCs. A-B, mice received nasal instillations (containing 5 mg DME/mL) daily for 5 days. Airway DCs were prepared and analyzed by RT-qPCR and ELISA. Bars show the quantities of Mettl5 mRNA (A) and protein (B) in cellular extracts of airway DCs. C-D, JAWSII cells were cultured in the presence of DME (1 µg/mL) for three days. The cells were analyzed using RT-qPCR and ELISA. Bars show the quantities of Mettl5 mRNA (C) and protein (D) in JAWSII cells. E, Mrc1 RNAi results. F-G, the amounts of total m6A (F) and methylated m6A (G) in airway DCs. The data of bars are presented as mean ± SD. Each bubble in bars presents one sample (assessed in triplicate). Statistics: AMOVA + Tukey HSD test. *p < 0.05; **p < 0.01; ****p < 0.0001. ns: Not significant. KO: Mrc1f/fItgax-Cre mice. cKO: Mrc1f/f mice. RNAi: Mrc1 RNAi. cRNAi: Control RNAi. Each group consists of 6 mice

Full size image

Mettl5 is involved in the DME-induced Timd4 gene transcription in DCs

DC-derived TIM4 plays a critical role in the initiation of Th2 response [4, 18]. TIM4 is encoded by the TIMD4 gene. We next assessed the relationship between Mettl5 and the DME-induced gene transcription of Timd4 in DCs. Mice received DME-containing nasal instillations daily for five days. DCs were isolated from the lung tissues using flow cytometry cell sorting. Hypomethylation status was found in the Timd4 promoter (Fig. 4A). The amount of gene transcription activity indicators, the RNA polymerase II (Pol II), was up regulated in DCs (Fig. 4B). Elevated amounts of Timd4 gene transcripts and the TIM4 protein were also detected in airway DCs (Fig. 4C-D). Conditional ablation of Mettl5 gene in DCs (using Mettl5f/fItgax-Cre mice) abolished the increased Timd4 transcription in airway DCs caused by DME (Fig. 4A-D). However, the amount of Mettl5 in airway DCs was not apparently different between DME-treated mice and PBS-treated mice (Fig. 4E). The results were verified in in vitro experiments. JAWSII cells (a mouse DC cell line) were stimulated by DME in culture. Hypomethylation was detected at the Timd4 promoter (Fig. 4F). The amounts of Pol II, Timd4 gene transcripts, and TIM4 protein were significantly increased in JAWSII cells by DME, which could be abolished by knockdown of the Mettl5 gene (Fig. 4G-I). Similar to the data obtained from the mouse experiments, the amount of Mettl5 was not apparently altered at the Timd4 promoter locus (Fig. 4J). Additionally, the data show that exposure to DME did not induce DCs apoptosis (Fig. 4K-L). The fact implies that Mettl5 influences the DME-induced expression of TIM4 in DCs through a different mechanism other than directly modulating the Timd4 gene activity.

Fig. 4
figure 4

Assessment of the role of Mettl5 in association with DME-induced Timd4 gene transcription. A-E, mice received nasal instillations (containing DME or PBS) daily for 5 days. Airway DCs were isolated and analyzed. A, the methylation status of the Timd4 promoter. B, the amount of Pol II at the Timd4 promoter. C-D, the amounts of TIM4 mRNA and protein in DCs. E, the amount of mettl5 at the Timd4 promoter. F-J, JAWSII cells (a cell line of DC) were stimulated with DME in culture for 2 days, and then analyzed. F, the methylation status of the Timd4 promoter. G, the amount of Pol II at the Timd4 promoter. H-I, the amounts of TIM4 mRNA and protein in DCs. J, the amount of mettl5 at the Timd4 promoter. K-L, gated plots show apoptotic DCs. Bars show counts of apoptotic DCs. The data of bars are presented as mean ± SD. Each bubble in bars presents one sample (assessed in triplicate). Statistics: AMOVA + Tukey HSD test. *p < 0.05; **p < 0.01; ***P < 0.001; ****p < 0.0001. KO: Mettl5f/fItgax-Cre mice. cKO: Mettl5f/f mice. Each group consists of 6 mice

Full size image

Degradation of interferon regulatory factor-5 (IRF5) is involved in the DME- and Mettl5-associated increase in TIM4 expression in DCs

The data reported above indicate that exposure to DME induces elevated expression of Mettl5 and the hypomethylation status at the Timd4 promoter in DCs. As Mettl5 is a methylase. It should not be responsible for the induction of hypomethylation at the Timd4 promoter. It is known that the IL-12-producing DCs induce the Th1 response. Thus, IL-12 and TIM4 have the opposite capacity to confer DCs with the ability to induce either a Th1 or Th2 response. Mutual inhibition may exist between them or between related signaling pathways. Thus, we inferred that Mettl5 may suppress IL-12 or its transcription factor, IRF5 [19, 20], in DCs to indirectly up regulate the activities of TIM4. To test the inference, airway DCs were isolated from mice treated with DME- or PBS-containing nasal instillations. The cellular extracts were prepared using the DCs and analyzed using ELISA. A decrease in the amounts of IRF5 and IL-12 was found in airway DCs of mice treated with DME (Fig. 5A-B). Then, the cells were analyzed using ChIP with an anti-Mettl5 Ab as a guide (Fig. 5C). Mettl5 was detected at the Irf5 promoter locus, which was significantly up regulated in DCs isolated from the DME-treated mice (Fig. 5D). The hypermethylation status was detected at the Irf5 promoter, and a decrease in the Irf5 gene transcription in airway DCs from mice treated with DME, which was abolished by conditional inhibition of the Mettl5 gene in DCs (Fig. 5G-I). The results demonstrate that exposure to DME can cause the hypermethylation status at the Irf5 promoter, and reduce its gene transcription in DCs.

Fig. 5
figure 5

Assessment of the role of Mettl5 in DME-induced reduction of IRF5 in DCs. Mice were treated with nasal instillations (containing DME or PBS) daily for five days. DCs were isolated from the airway tissues. A-B, the amounts of IRF5 (A) and IL-12 (B) in DCs. C, the amounts of Irf5 promoter DNA in ChIP products of DCs. D, the amounts of Mettl5 at the Irf5 promoter of DCs. E, the amounts of indicated histone types at the Irf5 promoter of DCs. F, methylation status of the Irf5 promoter of DCs. G-H, amounts of IRF5 mRNA (G) and protein (H) in DCs. I-P, cellular extracts were prepared from airway DCs of DME-treated mice, and analyzed by cross-ELISA. I-J, the amounts of IRF5 and STAT6 assessed with IRF5 Ab coated plates (I) and STAT6 Ab coated plates (J). K-L, the amounts of Trim24 assessed with IRF5 Ab (K) or STAT6 Ab (L) coated plates. M-O, the amounts of indicated items assessed with IRF5 Ab coated plates. P, HEK293 cells were transfected with plasmids of STAT6, or both STAT6 and IRF5. The bars show the amount of STAT6 protein in the cells. The data of bars are presented as mean ± SD. Each bubble in bars presents one sample (assessed in triplicate). Statistics: ANOVA + Tukey HSD test or Student’s t-test. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. ns: Not significant. KO: Mettl5f/fItgax-Cre mice. cKO: Mettl5f/f mice. IgG: isotype IgG. MG132: 100 nM. dTrim24: 5 µg/mL. Each group consists of 6 mice

Full size image

The above results suggest that there is a link between the increase in TIM4 expression caused by DME and the decrease in IRF5 expression in DCs. Following this hint, a cross-ELISA was conducted to analyze the cellular extracts of airway DCs. A complex of IRF5 and STAT6 (the gene transcription factor of the Timd4 gene [21]) was detected in airway DCs of mice treated with DME (Fig. 5H-I). It is known that Trim24 (tripartite motif-containing protein 24; a ubiquitin E3 ligase) promotes STAT6 ubiquitination [22]. We also detected that Trim24 attached to STAT6, but not IRF5, in the complex of IRF5 and STAT6 in airway DCs from mice treated with DME (Fig. 5J-K). We further found that ubiquitin, K48 and proteasome attached to STAT6 in the complex of IRF5 and STAT6 (Fig. 5L-N). On the other hand, HEK293 cells were transfected with plasmids of STAT6, or both STAT6 and IRF5. The amount of recombinant STAT6 could be suppressed by the presence of IRF5, which could be blocked by the presence of MG132 (an inhibitor of proteasome) or dTrim24 (an inhibitor of Trim24) in the culture (Fig. 5O). The results indicate that IRF5 recruits Trim24 to the complex, which causes STAT6 ubiquitination and degradation.

Inhibition of Mettl5 in DCs reconciles the DME-induced airway Th2 polarization and experimental AA

Previous studies have shown the important role of DC-derived TIM4 in the induction of Th2 polarization and the development of allergic disorders [4, 18]. The data mentioned above has shown that Mettl5 is a vital regulator of TIM4 expression in DCs. Thus, we inferred that the inhibition of Mettl5 might reconcile the DME-induced Th2 polarization and AA. To test this, an AA mouse model was established with DME as a specific antigen using established procedures [11]. The DME-sensitized mice showed an AA response, including lung inflammation (Fig. 6A), inflammatory cell infiltration (Fig. 6B), increases in sIgE, allergic mediators and Th2 cytokines in BALF (Fig. 6C-H). Conditional ablation of the Mettl5 gene in DCs resulted in a significant attenuation of the AA response (Fig. 6A-H). The results indicate that the expression of Mettl5 in DCs plays a crucial role in the development of AA.

Fig. 6
figure 6

Inhibition of Mettl5 suppresses airway Th2 polarization and experimental AA. A, representative lung histology images (Original magnification: ×100) of 20 images per group. B, cell counts in BALF. C-H, the amounts of indicated items in BALF. I-K, airway DCs were cocultured with naïve CD4+ T cells for 3 days. I, the bars indicate DC-induced IL-4+CD25+ T cells. J, CD3+CD4+ T cells were gated, from which IL-4+CD25+ T cells were gated (K). The data of bars are presented as mean ± SD. Each bubble in bars presents one sample (assessed in triplicate). Statistics: ANOVA + Tukey HSD test. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. KO: Mettl5f/fItgax-Cre mice. cKO: Mettl5f/f mice. Each group consists of 6 mice

Full size image

On the other hand, airway DCs were isolated from the mice and cultured with naive CD4+ T cells. We found that DCs from DME-sensitized Mettl5f/f mice induced about 5–8% IL-4+CD4+ T cells. While less than 1–2% of IL-4+CD4+ T cells were induced by DME-sensitized Mettl5f/fItgax-Cre mice (Fig. 6I-K). The results reinforce the importance of Mettl5 in DCs in the induction of Th2 cells.

Discussion

It is a well-known fact that Th2 polarization is a vital factor in the progression of AA and other allergic disorders. DCs are the primary cells that initiate a Th2 response [2]. The mechanism of Th2 polarization has not yet been fully understood. Current data indicate that the development of Th2 polarization and AA is greatly influenced by Mettl5 elevation in DCs.

Current data show that Mettl5 is a critical player in the development of airway Th2 polarization and AA. Others have also found elevated methylation of Mettl3 in DCs, which promotes DC maturation [23]. Mettl5 is a methylase. Previous studies indicate that Mettl5 is one of the enzymes responsible for the methylation of m6A [24]. Published data have revealed that the m6A methylation is an important factor in the pathogenesis of AA. Han et al. reported that methylation of m6A drives the differentiation of M2 macrophages, which facilitates the development of allergic asthma [7]. Mo et al. analyzed several datasets of single cell sequencing studies and identified a series of m6A-related genes (FTO, IGF2BP2, RBM15, RBMX, WTAP, and YTHDC1), which were abnormally expressed in patients with allergic asthma [8]. Fan and colleagues found an increase in global m6A levels in asthma patients, which was associated with a decrease in Foxp3 regulatory T cell frequencies [25]. Current study has revealed that Mettl5, which is related to m6A methylation, can also influence the property of DC besides acting on m6A.

DCs are the primary immune cells that start an immune response. DCs capture antigens, process them, and transfer the antigen information, along with relevant cytokines to CD4+ T cells. Antigen-pulsed DCs are capable of inducing either antigen-specific Th1 cells, Th2 cells, or regulatory T cells. The cytokines that accompany DCs are crucial in directing targeted T cells to develop into appropriate phenotypes [2]. The present data show that the high expression of Mettl5 in airway DCs is positively correlated with the AA response. Th2 polarization is the major part of the AA response. Thus, it is necessary to consider the association between the Mettl5 expression in DCs and the development of Th2 polarization.

The data show that DME up regulates the expression of Mettl5 in DCs. MRC1 mediates the effects of DME. This is in line with previous studies, in which the authors demonstrate that MRC1 mediates the uptake of Der P1 and Der P2 [17]. Der P1 and Der P2 are the major antigen proteins of DME. Our data show that inhibition of the Mrc1 gene abolishes the DME-induced expression of Mettl5 in DCs. MRC1 is commonly expressed in DCs [17]. Our study shows that MRC1 has a unique functional aspect that can regulate the expression of Mettl5 in DCs by mite antigens.

The data show that the elevated amount of Mettl5 in DCs is associated with the expression of TIM4 in DCs. TIM4 is associated with the development of Th2 polarization [5]. By interaction with TIM1 in activated CD4+ T cells, TIM4 drives the development of Th2 cells [4, 5, 18]. Previous studies indicate that DC-derived TIM4 is crucial in the development of Th2 polarization and the development of allergic diseases [5]. The factors that promote it have not been recognized. Current data have amended this deficit by showing that DME can induce the expression of Mettl5 in DCs, which further induces the expression of TIM4 in DCs.

It is known that Mettl5 is a methylase. The essential function of it is to up regulate the methylation status of targeted molecules such as m6A [26]. Due to the lack of significant differences in m6A methylation in airway DCs after exposure to DME, we investigated other possible reasons for this event. The data show that although the elevated amount of Mettl5 in airway DCs was positively correlated with the AA response, and the TIM4 expression was up regulated in DCs by DME, the amount of Mettl5 in the Timd4 promoter was not increased. The fact indicates that Mettl5 may indirectly regulate the transcription of the Timd4 gene in DCs.

In response to antigen stimuli, DCs may differentiate into different phenotypes, which induce the development of Th1 cells, Th2 cells, or regulatory T cells [27]. According to the data, DME exposure increased TIM4, but not IL-12 or IL-10. This raises the possibility that exposure to DME may result in the suppression of IL-12 activities in DCs. The data imply that TIM4 and IL-12 or related signals may interact or influence each other. Our data have added novel information to this point by showing that the DME-induced Mettl5 hindered the expression of IL-12 in DCs. The underlying mechanism is that Mettl5 induces hypermethylation of the Irf5 promoter. As a consequence, the production of IRF5 is reduced. IRF5 is a transcription factor. It plays a critical role in the gene transcription of IL-12 [20]. Our data demonstrate that in response to the stimulation of DME, DCs produce less amounts of IRF5 and IL-12, but more amounts of Mettl5 and TIM4. The data form a scenario that DME induces Mettl5, which suppresses the production of IRF5 and IL-12. The reduction of IRF5 or IL-12 production may be the factor that promotes the production of TIM4 in DCs. However, the mechanism by which exposure to DME induces DCs to express Mettl5, and if this event influence the systemic immune response needs to be further investigated.

The data show a complex of IRF5 and STAT6 in DCs. Concomitantly, ubiquitin, K48, and proteasome were found attaching to STAT6, but not IRF5, in the complex. Ubiquitination is one of the major pathways by which proteins are degraded [28]. The data indicate that IRF5 binds to STAT6, and meanwhile, IRF5 recruits ubiquitin to the complex to bind to STAT6. As a result, the STAT6 gets degradation through the proteasome mechanism. The importance of this event lies in the fact that IRF5 can limit the amount of STAT6 to a proper range. In other words, IRF5 maintains the balance of TIM4 and IL-12 in DCs. The disturbance of IRF5 may disrupt this balance. As shown by the present data, DME can be one of the factors that disturb the homeostasis of DCs by decreasing the expression of IRF5. The decrease in IRF5 results in more abundance of STAT6, which promotes the expression of TIM4 as STAT6 is the transcription factor of Timd4 [21]. Subsequently, the Th2 polarization occurs in the local tissues [5, 18].

Previous studies have identified the beneficial effects of regulating Mettl5. Xia et al. report that inhibiting Mettl5 suppresses hepatocellular cancer growth and metastasis [29]. Dai et al. found that inhibition of Mettl5 reduced the oncogenic translation in intrahepatic cholangiocarcinoma [30]. Xu et al. reported that suppressing Mettl5 could inhibit the expression of PD-L1 to reduce the immune escape of hypocellular carcinoma [31]. Our data indicate that the Mettl5 inhibition can effectively mitigate experimental AA. The underlying mechanism could be that the inhibition of Mettl5 reduces the production of TIM4 by DCs. As the interaction of TIM4 and TIM1 plays a critical role in the development of Th2 polarization [4, 5, 18]. Th2 cytokines are required in the induction of IgE-producing plasma cells [32]. Thus, the inhibition of Mettl5 results in suppressing the production of IgE. On the other hand, mast cell sensitization by IgE is the mainstay of allergic attacks. The reduction of IgE production caused by inhibition of Mettl5 results in a decrease in mast cell activation, as shown by the present data. It plays a role in the suppression of AA. Administration of anti-IgE Ab has achieved satisfactory effects on controlling the symptoms of allergic diseases [33]. We also observed that inhibition of Mettl5 reduced the production of IL-5. IL-5 is a critical factor for the development of eosinophils. Inhibition of IL-5 by using proper inhibitors (such as anti-IL-5 Ab) can reduce the development of eosinophils and mitigate allergy attacks [34]. Therefore, Mettl5 inhibition has the potential to be a drug candidate for treating AA and other allergic disorders.

It is evident from the data that the methylation of IRF5 in DCs by Mettl5 leads to the facilitation of the development of Th2 response. According to Han and colleagues, inhibiting Mettl3 results in M2 macrophage activation, which in turn increases Th2 cell response and exacerbates AA inflammation [7]. Qi and colleagues determined that the methylation profiles of nasal brush samples had a high correlation with the diseases of allergic rhinitis or asthma, which could be linked to the development of AA [35]. Further investigation is warranted as abnormal methylation appears to be a significant factor in the development of AA [36].

In summary, an elevated amount of Mettl5 was found in airway DCs, which promoted the expression of TIM4. As a result, the Mettl5-producing DCs promoted the development of airway Th2 polarization and AA. Inhibition of Mettl5 can mitigate experimental AA through inhibiting the production of TIM4 and the development of Th2 response, suggesting that inhibition of Mettl5 has the translation potential to be used in the treatment of AA.

Data availability

Data are available upon request.

Abbreviations

DCs:

Dendritic cells

AA:

Airway Allergy

m6A:

N6-methyladenosine

DME:

Dust Mite Extracts

ChIP:

Chromatin Immunoprecipitation

sIgE:

antigen-specific IgE

EPX:

Eosinophil Peroxidase

Mcpt1:

Mouse Mast cell protease-1

BALF:

Bronchoalveolar Lavage Fluid

IRF5:

Interferon Regulatory Factor-5

ELISA:

Enzyme-Linked Immunosorbent Assay

References

  1. Worbs T, Hammerschmidt SI, Förster R. Dendritic cell migration in health and disease. Nat Rev Immunol. 2017;17:30–48.

    Article  CAS  PubMed  Google Scholar 

  2. Yin X, Chen S, Eisenbarth SC. Dendritic Cell Regulation of T Helper Cells. Annu Rev Immunol. 2021;39:759–90.

    Article  CAS  PubMed  Google Scholar 

  3. Oriss TB, Raundhal M, Morse C, Huff RE, Das S, Hannum R, Gauthier MC, Scholl KL, Chakraborty K, Nouraie SM et al. IRF5 distinguishes severe asthma in humans and drives Th1 phenotype and airway hyperreactivity in mice. JCI Insight 2017, 2.

  4. Meyers JH, Chakravarti S, Schlesinger D, Illes Z, Waldner H, Umetsu SE, Kenny J, Zheng XX, Umetsu DT, DeKruyff RH, et al. TIM-4 is the ligand for TIM-1, and the TIM-1-TIM-4 interaction regulates T cell proliferation. Nat Immunol. 2005;6:455–64.

    Article  CAS  PubMed  Google Scholar 

  5. Yang PC, Xing Z, Berin CM, Soderholm JD, Feng BS, Wu L, Yeh C. TIM-4 expressed by mucosal dendritic cells plays a critical role in food antigen-specific Th2 differentiation and intestinal allergy. Gastroenterology. 2007;133:1522–33.

    Article  CAS  PubMed  Google Scholar 

  6. Silva TC, Young JI, Martin ER, Chen XS, Wang L. MethReg: estimating the regulatory potential of DNA methylation in gene transcription. Nucleic Acids Res. 2022;50:e51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Han X, Liu L, Huang S, Xiao W, Gao Y, Zhou W, Zhang C, Zheng H, Yang L, Xie X, et al. RNA m(6)A methylation modulates airway inflammation in allergic asthma via PTX3-dependent macrophage homeostasis. Nat Commun. 2023;14:7328.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Mo BW, Li XM, Li SM, Xiao B, Yang J, Li HM. m6A echoes with DNA methylation: Coordinated DNA methylation and gene expression data analysis identified critical m6A genes associated with asthma. Gene. 2022;828:146457.

    Article  CAS  PubMed  Google Scholar 

  9. Qin Y, Li L, Luo E, Hou J, Yan G, Wang D, Qiao Y, Tang C. Role of m6A RNA methylation in cardiovascular disease (Review). Int J Mol Med. 2020;46:1958–72.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Wang L, Peng JL. METTL5 serves as a diagnostic and prognostic biomarker in hepatocellular carcinoma by influencing the immune microenvironment. Sci Rep. 2023;13:10755.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Yang G, Zeng XH, Geng XR, Liu JQ, Mo LH, Luo XQ, Liu HZ, Zhang YY, Yang LT, Huang QM, et al. The transcription factor XBP1 in dendritic cells promotes the T(H)2 cell response in airway allergy. Sci Signal. 2023;16:eabm9454.

    Article  CAS  PubMed  Google Scholar 

  12. Gao X, Leung TF, Wong GW, Ko WH, Cai M, He EJ, Chu IM, Tsang MS, Chan BC, Ling J, et al. Meteorin-β/Meteorin like/IL-41 attenuates airway inflammation in house dust mite-induced allergic asthma. Cell Mol Immunol. 2022;19:245–59.

    Article  CAS  PubMed  Google Scholar 

  13. Staudt V, Bothur E, Klein M, Lingnau K, Reuter S, Grebe N, Gerlitzki B, Hoffmann M, Ulges A, Taube C, et al. Interferon-regulatory factor 4 is essential for the developmental program of T helper 9 cells. Immunity. 2010;33:192–202.

    Article  CAS  PubMed  Google Scholar 

  14. Ettreiki C, Chango A, Barbezier N, Coeffier M, Anton PM, Delayre-Orthez C. Prevention of Adult Colitis by Oral Ferric Iron in Juvenile Mice Is Associated with the Inhibition of the Tbet Promoter Hypomethylation and Gene Overexpression. Nutrients 2019, 11.

  15. Muthumanickam P, Ramasubramanian A, Pandi C, Kannan B, Pandi A, Ramani P, Jayaseelan VP, Arumugam P. The novel m6A writer methyltransferase 5 is a promising prognostic biomarker and associated with immune cell infiltration in oral squamous cell carcinoma. J Oral Pathol Med. 2024;53:521–9.

    Article  CAS  PubMed  Google Scholar 

  16. Huang WZ, Hu WH, Wang Y, Chen J, Hu ZQ, Zhou J, Liu L, Qiu W, Tang FZ, Zhang SC, et al. A Mathematical Modelling of Initiation of Dendritic Cells-Induced T Cell Immune Response. Int J Biol Sci. 2019;15:1396–403.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Deslée G, Charbonnier AS, Hammad H, Angyalosi G, Tillie-Leblond I, Mantovani A, Tonnel AB, Pestel J. Involvement of the mannose receptor in the uptake of Der p 1, a major mite allergen, by human dendritic cells. J Allergy Clin Immunol. 2002;110:763–70.

    Article  PubMed  Google Scholar 

  18. Feng BS, Chen X, He SH, Zheng PY, Foster J, Xing Z, Bienenstock J, Yang PC. Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 2008;122:55–61. 61.e51-57.

    Article  CAS  PubMed  Google Scholar 

  19. Pereira M, Ramalho T, Andrade WA, Durso DF, Souza MC, Fitzgerald KA, Golenbock DT, Silverman N, Gazzinelli RT. The IRAK1/IRF5 axis initiates IL-12 response by dendritic cells and control of Toxoplasma gondii infection. Cell Rep. 2024;43:113795.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Li F, Wang H, Li YQ, Gu Y, Jia XM. C-type lectin receptor 2d forms homodimers and heterodimers with TLR2 to negatively regulate IRF5-mediated antifungal immunity. Nat Commun. 2023;14:6718.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Yang B, Luo Y, Liu Z, Yang P, Gui Y. Probiotics SOD inhibited food allergy via downregulation of STAT6-TIM4 signaling on DCs. Mol Immunol. 2018;103:71–7.

    Article  CAS  PubMed  Google Scholar 

  22. Yu T, Gan S, Zhu Q, Dai D, Li N, Wang H, Chen X, Hou D, Wang Y, Pan Q, et al. Modulation of M2 macrophage polarization by the crosstalk between Stat6 and Trim24. Nat Commun. 2019;10:4353.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Wang H, Hu X, Huang M, Liu J, Gu Y, Ma L, Zhou Q, Cao X. Mettl3-mediated mRNA m(6)A methylation promotes dendritic cell activation. Nat Commun. 2019;10:1898.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Sendinc E, Shi Y. RNA m6A methylation across the transcriptome. Mol Cell. 2023;83:428–41.

    Article  CAS  PubMed  Google Scholar 

  25. Fan L, Wu J, Wang H, Chen Q, He X, Wang Q, Yang Z. METTL3-Mediated N6-Methyladenosine Methylation Modifies Foxp3 mRNA Levels and Affects the Treg Cells Proportion in Peripheral Blood of Patients with Asthma. Ann Clin Lab Sci. 2022;52:884–94.

    CAS  PubMed  Google Scholar 

  26. van Tran N, Ernst FGM, Hawley BR, Zorbas C, Ulryck N, Hackert P, Bohnsack KE, Bohnsack MT, Jaffrey SR, Graille M, Lafontaine DLJ. The human 18S rRNA m6A methyltransferase METTL5 is stabilized by TRMT112. Nucleic Acids Res. 2019;47:7719–33.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Hilligan KL, Ronchese F. Antigen presentation by dendritic cells and their instruction of CD4 + T helper cell responses. Cell Mol Immunol. 2020;17:587–99.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Carroll EC, Marqusee S. Site-specific ubiquitination: Deconstructing the degradation tag. Curr Opin Struct Biol. 2022;73:102345.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Xia P, Zhang H, Lu H, Xu K, Jiang X, Jiang Y, Gongye X, Chen Z, Liu J, Chen X, et al. METTL5 stabilizes c-Myc by facilitating USP5 translation to reprogram glucose metabolism and promote hepatocellular carcinoma progression. Cancer Commun (Lond). 2023;43:338–64.

    Article  PubMed  Google Scholar 

  30. Dai Z, Zhu W, Hou Y, Zhang X, Ren X, Lei K, Liao J, Liu H, Chen Z, Peng S, et al. METTL5-mediated 18S rRNA m(6)A modification promotes oncogenic mRNA translation and intrahepatic cholangiocarcinoma progression. Mol Ther. 2023;31:3225–42.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Xu W, Liu S, Zhang G, Liu J, Cao G. Knockdown of METTL5 inhibits the Myc pathway to downregulate PD-L1 expression and inhibits immune escape of hepatocellular carcinoma cells. J Chemother. 2023;35:455–64.

    Article  CAS  PubMed  Google Scholar 

  32. Wade-Vallance AK, Allen CDC. Intrinsic and extrinsic regulation of IgE B cell responses. Curr Opin Immunol. 2021;72:221–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Wood RA, Togias A, Sicherer SH, Shreffler WG, Kim EH, Jones SM, Leung DYM, Vickery BP, Bird JA, Spergel JM, et al. Omalizumab for the Treatment of Multiple Food Allergies. N Engl J Med. 2024;390:889–99.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Farne HA, Wilson A, Milan S, Banchoff E, Yang F, Powell CV. Anti-IL-5 therapies for asthma. Cochrane Database Syst Rev. 2022;7:Cd010834.

    PubMed  Google Scholar 

  35. Qi C, Jiang Y, Yang IV, Forno E, Wang T, Vonk JM, Gehring U, Smit HA, Milanzi EB, Carpaij OA, et al. Nasal DNA methylation profiling of asthma and rhinitis. J Allergy Clin Immunol. 2020;145:1655–63.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Yang H, Na FY, Guo L, Liang X, Zhang RF. The landscape of DNA methylation in asthma: a data mining and validation. Bioengineered. 2021;12:10063–72.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

This study was supported by research grants of the National Natural Science Foundation of China (82371122, 32090052), Shenzhen Key Medical Discipline Construction Fund (SZXK062), Guangdong Provincial Natural Science Fund (2022A1515012617), and Longgang District Scientific Technological Research Fund (LGKCYLWS2023008).

Funding

None.

Author information

Author notes

  1. Xiwen Zhang, Haoyue Zheng and Yixuan Dong contributed equally to this work.

Authors and Affiliations

  1. Department of Otolaryngology of Longgang Central Hospital and Clinical College Affiliated to Guangzhou University of Chinese Medicine, Shenzhen, China

    Xiwen Zhang, Haoyue Zheng, Yixuan Dong, Hanqing Zhang, Le Liu, Bailing Xie, Pingchang Yang & Xiaoyu Liu

  2. State Key Laboratory of Respiratory Diseases Allergy Division at Shenzhen University, Institute of Allergy & Immunology of Shenzhen University, and Shenzhen Key Laboratory of Allergy & Immunololgy, Shenzhen, China

    Xiwen Zhang, Haoyue Zheng, Yixuan Dong & Gui Yang

  3. Department of Immunology & Key Laboratory of Tropical Translational Medicine of Ministry of Education & Department of Immunology, School of Basic Medicine and Life Sciences, Hainan Medical University, Haikou, China

    Yuanyi Zhang

  4. Department of Immunology, Basic Medical College of Weifang Medical University, Weifang, China

    Lingzhi Xu

  5. Department of General Practice Medicine, Third Affiliated Hospital of Shenzhen University, Shenzhen, China

    Lihua Mo & Yu Liu

Authors
  1. Xiwen Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Haoyue Zheng
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Yixuan Dong
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Hanqing Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Le Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Yuanyi Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Lingzhi Xu
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Bailing Xie
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Lihua Mo
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Yu Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Gui Yang
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Pingchang Yang
    View author publications

    You can also search for this author inPubMed Google Scholar

  13. Xiaoyu Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Zhang X, Zheng H, Dong Y, Zhang H, Liu L, Zhang Y, Xu L, Xie B, Mo L and Liu Y performed experiments, analyzed data, and reviewed manuscript. Liu X, Yang G and Yang P organized the study, supervised experiments, designed the project and prepared the manuscript. All authors reviewed the manuscript.

Corresponding authors

Correspondence to Gui Yang, Pingchang Yang or Xiaoyu Liu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zhang, X., Zheng, H., Dong, Y. et al. Dust mite antigens endow dendritic cells with the capacity to induce a Th2 response by regulating their methylation profiles. Cell Commun Signal 22, 606 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12964-024-01986-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12964-024-01986-z

Keywords

Cell Communication and Signaling

ISSN: 1478-811X