Skip to main content
Download PDF

Cytochrome P450 2E1 aggravates DXR-induced myocardial injury through imbalanced mitochondrial OPA1

Cell Communication and Signaling volume 23, Article number: 208 (2025) Cite this article

Abstract

Background

Cytochrome P450 2E1 (CYP2E1), a drug metabolism enzyme, is linked to multiple pathophysiological states in the myocardium and may act as a sensor of heart diseases. However, the exact mechanisms of CYP2E1 in myocardial injury, particularly in chemotherapeutic agent-induced myocardial damage such as doxorubicin-induced cardiotoxicity, remain unclear.

Methods

Using multiple animal models of cardiomyopathy and heart failure, we observed CYP2E1 expression in myocardial mitochondria. Myocardium-specific CYP2E1 overexpression and knockout rat models were employed to study its effects on myocardial injury, assessed via echocardiography and histopathology. Mechanistic insights were derived from transcriptome analysis, mass spectrometry, co-immunoprecipitation, signal transduction analysis, and molecular biology techniques.

Results

CYP2E1 overexpression accelerated, while CYP2E1 knockout inhibited, myocardial injury in DXR-induced cardiomyopathy and isoprenaline-induced hypertrophic cardiomyopathy. Mechanistically, CYP2E1 was upregulated specifically in myocardial mitochondria during heart disease. This upregulation resulted in mitochondrial fragmentation and dysfunction under DXR-induced stress. CYP2E1 interacted with optic atrophy 1 (OPA1) in the inner mitochondrial membrane, leading to an imbalance between long and short OPA1 isoforms.

Conclusions

CYP2E1 disrupts OPA1-mediated mitochondrial dynamics, causing mitochondrial fragmentation and apoptosis, which aggravate myocardial injury. Targeting CYP2E1 may offer a therapeutic strategy to mitigate myocardial damage, particularly in chemotherapeutic drug-induced cardiotoxicity.

Graphical Abstract

Introduction

Cytochrome P450 2E1 (CYP2E1) is integral to drug metabolism and cellular responses to stress and injury. It metabolizes various small molecules, drugs, and pollutants, producing bioactive metabolites [1, 2]. CYP2E1 has been implicated in hepatotoxicity induced by alcohol metabolism and exogenous toxicants, playing a central role in nonalcoholic steatohepatitis and other liver diseases [3,4,5,6]. Although CYP2E1 is abundant in the liver, it also presents in the brain, kidney, skin, heart, lung, and skeletal muscle [2, 6]. Moreover, its expression is regulated by genetic polymorphisms, endogenous hormones, cytokines, xenobiotics, and various pathological states [1, 2, 7, 8]. In recent decades, CYP2E1 has been linked to progressive metabolic disorders such as obesity and diabetes [9,10,11,12,13].

CYP2E1 is found in the endoplasmic reticulum (ER), plasma membrane, Golgi apparatus, and mitochondria (mt) [6, 14,15,16,17,18]. Although mitochondria mitochondria-associated CYP2E1 (mtCYP2E1) was discovered two decades ago, research has primarily focused on CYP2E1 in the ER (erCYP2E1) [2, 5, 19]. Interest in mtCYP2E1 has been increasing steming from its role in disease pathogenesis, linked to its activity and localization [5, 14, 16, 18, 20,21,22]. Over 40% CYP2E1 is in the mitochondria of rat liver [16, 23]. mtCYP2E1 is linked to alcohol-related liver diseases, xenobiotic-induced hepatotoxicity, and nonalcoholic fatty liver ailment, involving mitochondrial oxidative stress and membrane potential damage [8, 20, 21, 24]. mtCYP2E1 has also been detected in the brain, pancreas, and other tissues, where it contributes to disease progression [17, 22, 25].

Interestingly, we recently found that CYP2E1 is specifically upregulated in the mitochondria of myocardial tissues under various heart diseases. Abnormal CYP2E1 expression also affects the mitochondrial morphology of cardiomyocytes. Therefore, we speculate that CYP2E1 participates in cardiomyocyte regulation. This implies that CYP2E1 may regulate myocardial injury, potentially through mitochondrial pathways. Mitochondria are crucial for generating reactive oxygen species (ROS), energy production, cell apoptosis, and calcium homeostasis in cardiomyocytes [26]. However, the specific effects of upregulated mitochondrial CYP2E1 on cardiac pathology and the differences in molecular mechanisms between the myocardium and other tissues remain unclear.

CYP2E1 is a major isoform in ventricular myocytes [27], and its polymorphisms have been shown to interact with polycyclic aromatic hydrocarbons, influencing the probability of congenital heart diseases (CHDs) [28]. Our previous research suggests that CYP2E1 acts as a sensor of heart diseases, interacting with various pathophysiological factors in the myocardium [7]. CYP2E1 overexpression increases oxidative stress and apoptosis while silencing endogenous CYP2E1 prevents the progression of hereditary dilated cardiomyopathy in mouse models [29, 30]. However, the precise molecular mechanisms by which CYP2E1 mediates myocardial injury and apoptosis remain unclear.

This study examined the biological properties and pathological consequences of CYP2E1 in doxorubicin (DXR)-induced cardiomyopathy and isoprenaline (ISO)-induced hypertrophic cardiomyopathy. We also explored the role of CYP2E1 in regulating mitochondrial dynamics in myocardium. Our findings may provide new insights and therapeutic targets for myocardial injury in conditions involving drug metabolism enzymes.

Methods

Data collection

The expression profiling dataset GSE116250 was extracted from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), including 64 human left ventricular tissue samples: 14 controls, 37 with dilated cardiomyopathy, and 13 with ischemic cardiomyopathy. Corresponding clinical data were also downloaded. As this study relies on publicly available data, no ethical issues or conflicts of interest arise.

Animal models

All mice and rats were bred in a pathogen-free facility. Procedures were conducted with approval from the Institutional Animal Care and Use Committee of the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, and Peking Union Medical College (IACUC-ZLF18001), complying with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. Animals were euthanized via > 4.5% isoflurane in oxygen via a precision vaporizer with an induction chamber and a waste gas scavenger until respiratory arrest occurred for more than 60 s. Rapid exsanguination via vena cava puncture ensured euthanasia before organ harvest.

Generation of transgenic and genetically modified animal models

The α-MHC-Cre transgenic rats [31] were recognized by PCR using Cre-F (AACATGCTTCATCGTCGGTC) and Cre-R (GTGCCTTCTCTACACCTGCG) primers and maintained by crossing with Sprague Dawley (SD) wild-type rats. The Cyp2e1flox/+ rats (Cyp2e1 cKO) were established by inserting loxP sites flanking exon 2 using the CRISPR/Cas9 with two sets of sgRNAs: sgRNA1 (TAGGCAACCCAGCAACTTAAGG/AAACCCTTAAGTTGCTGGGTTG) and sgRNA2 (TAGGGTTGGCTTCTTAGGACAT/AAACATGTCCTAAGAAGCCAAC). A donor vector (4 ng/µl), Cas9 mRNA (25 ng/µl), and sgRNAs (10 ng/µl each) were mixed and microinjected into the cytoplasm and male pronucleus of fertilized eggs, which were subsequently implanted into pseudo-pregnant SD rats for gestation. Genomic DNA was prepared as previously reported [31], and successful integration of loxP sites was confirmed by PCR amplification of an 1889 bp fragment using Cyp2e1flox/+ F (5’ TGGAAGCAGATCTATAACAGTTGGAAC) and Cyp2e1flox/+ R (5’ TAAGAAGGTGCAGGTAAGACGGAG) primers with 35 cycles of 30 s at 95 °C, 30 s at 59 °C and 2 min at 72 °C. The generated Cyp2e1flox/+ rats were maintained by breeding wild-type SD rats.

Cardiac-specific Cyp2e1 knockout rats were established with the Cre-loxP system. Initially, α-MHC-Cre rats were crossed with Cyp2e1flox/+ rats to generate offspring with Cyp2e1flox/+/α-MHC-Cre. These rats were then crossed with Cyp2e1flox/+ rats, producing pups with genotype Cyp2e1flox/flox/α-MHC-Cre (Cyp2e1-KO rats), which were used for subsequent studies (Fig. 2C). Control rats (CON) included Cyp2e1flox/+ and Cyp2e1flox/flox littermates, lacking the α-MHC-Cre transgene.

To generate myocardium-specific Cyp2e1-overexpression rats (Cyp2e1-OV), full-length human Cyp2e1 cDNA was inserted into an expression vector under the α-MHC promoter (Fig. 2F). The plasmid was microinjected into fertilized eggs, and positive transgenic rats were confirmed by PCR amplification of an 1112 bp fragment using αMHC-promoter-F (5’ TGTAGACAGCAGATCACGATTCTC) and αMHC-h-Cyp2e1-R (5’ ATTTCCACGAGCAGGCAGTC) primers with 30 cycles of 30 s at 94 °C, 40 s at 58 °C, and 60s at 72 °C. The produced transgenic rats were sustained by breeding with SD wild-type rats (Fig. 2G).

We have previously generated α-MHC-cTnTR92Q (cTnTR92Q) familial hypertrophic cardiomyopathy (FHCM) and α-MHC-cTnTR141W (cTnTR141W) familial dilated cardiomyopathy (FDCM) transgenic mice, manifesting ventricular wall hypertrophy, reduced ventricular chambers, and diastolic dysfunction, reflecting pathological features of human HCM [32] and dilated chambers, thin walls, and cardiac dysfunction, mirroring human DCM [29, 32, 33], respectively. Genotyping for both strains was performed using PCR.

DXR treatment

Two-month-old SD rats or myocardium-specific genetically modified CYP2E1 rats were subjected to DXR treatment. DXR (Shenzhen Wanle Pharmaceutical Co., Ltd, China) was administrated intraperitoneally at 2.5 mg/kg in a constant saline volume every other day for 14 days, following established protocols [34, 35]. Control groups received equivalent volumes of saline. Echocardiography was performed two weeks after cessation of DXR treatment, and hearts were either fixed in formalin or snap-frozen in liquid nitrogen for further investigations (Fig. 1B).

Fig. 1
figure 1

CYP2E1 Expression in myocardial mitochondria under various heart diseases. (A) CYP2E1 expression in left ventricular myocardial tissue from clinical dilated cardiomyopathy (DCM) and ischemic cardiomyopathy (ICM) samples. Data were analyzed using GSE116250 dataset from GEO and presented as RPKM (Reads Per Kilobase per Million mapped reads); n = 14 for non-heart failure donor group, n = 37 for DCM group, and n = 13 for ICM group. (B) Schematic representation of animal model establishment and experimental strategy for analyzing expression characteristics. Abbreviations: DXR, doxorubicin; AngII, angiotensin II; ISO, isoprenaline. (C) CYP2E1 protein levels in total protein and mitochondrial protein extracts from cardiac tissues in the animal models, determined via immunoblotting. (D-E) Quantification of CYP2E1 expression in total and mitochondrial protein extracts, normalized to GAPDH or VDAC1. Data shown are mean ± SEM; n = 4 per group. (F) CYP2E1 distribution in myocardial tissue from DXR-induced myocardial injury rat model and ISO-induced myocardial hypertrophy rat model via immunofluorescence. Colocalization of CYP2E1 (red) and ATP5A (mitochondrial marker, green) is indicated by white arrows. DAPI (blue) and F-actin (purple) are used as nuclear and myocardial structure markers, respectively. Scale bars: 20 μm. Multiple comparisons were conducted using ANOVA with Tukey correction. Two-group comparisons were executed using unpaired two-tailed Student’s t-tests. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

Isoprenaline (ISO) treatment

Two-month-old rats were anesthetized with 1.5−2.5% isoflurane, followed by a mid-scapular incision for implantation of osmotic pumps (Alzet mode 2004, USA) containing ISO at 5.0 mg/kg/day (Sigma, USA). Sham group rats were subjected to the same procedure with their pumps filled with saline. Echocardiography was conducted 28 days post-implantation, after which hearts were either fixed in formalin or snap-frozen in liquid nitrogen for further investigations (Fig. 1B) [36].

Angiotensin II (ANG II) treatment

Two-month-old rats were anesthetized with 1.5–2.5% isoflurane, followed by a mid-scapular incision for implantation of osmotic pumps (Alzet Model 2004, USA) containing angiotensin II (ANG II) at 0.3 mg/kg/day (Merck, USA). Sham group rats underwent the same surgical procedure, but their pumps were filled with saline. Echocardiography was conducted 28 days post-implantation, after which hearts were either fixed in formalin or snap-frozen in liquid nitrogen for further investigations (Fig. 1B) [37, 38].

Echocardiography

Echocardiographic analysis was performed using the FUJIFILM VisualSonics, Vevo3100 small animal echocardiography system (Canada), following established protocols [37, 39]. Rats were anesthetized with 1.5–2.5% isoflurane, ensuring heart rate and body temperature maintenance throughout the procedure. Left ventricular (LV) posterior wall thickness at end-systole (LVPWs) and diastole (LVPWd), LV anterior wall thickness at end-systole (LVAWs) and diastole (LVAWd), LV internal diameter at end-systole (LVIDs) and diastole (LVIDd), fractional shortening (FS), and ejection fraction (EF) were measured for minimal three consecutive cardiac cycles using Vevo LAB 5.7.0.

Protein extraction and immunoblotting

Proteins were extracted from rat cardiac tissues per the supplier’s instructions (Thermo Fisher, 78505, USA). Mitochondrial and cytosolic portions were isolated using a mitochondria fractionation kit (Beyotime, C3606, China), and microsomal fractions were obtained using a microsome fractionation kit (Solarbio, EX1931, China), as per the provided protocols [39]. Protease inhibitors (Beyotime, P1011, China), phosphatase inhibitors (Beyotime, P1082, China), and PMSF (Thermo Fisher, 36978, USA) were added to all protein extraction buffers. Proteins were subjected to SDS-PAGE, migrated onto nitrocellulose membranes, and incubated overnight at 4℃ with rabbit monoclonal anti-cytochrome c (CST, 11940, 1:1000, USA), anti-caspase-3 (CST, 9662, 1:1000, USA), and anti-cleaved caspase-3 (CST, 9664, 1:1000, USA), rabbit polyclonal anti-Drp1 (ABclonal, A2586, 1:1000, China), anti-CYP2E1 (Abcam, ab19140, 1:500, UK), anti-Nppa (Abcam, ab180649, 1:500, UK), anti-SDHA (ABclonal, A2594, 1:1000, China), anti-SDHB (ABclonal, A10821, 1:1000, China), anti-CYTB (ABclonal, A17966, 1:1500, China) and anti-phosphorylated Drp1 (Abcam, ABclonal, AP1353, 1:1000, China; ab193216, 1:1000, UK), and mouse monoclonal anti-calnexin (Proteintech, 66903-1-Ig, 1:5000, USA), anti-NDUFS1 (Abcam, ab52690, 1:500, UK) and anti-VDAC1 (Abcam, ab14734, 1:500, UK) antibodies. After washes, membranes were reacted with goat anti-rabbit IgG H&L (HRP) or goat anti-mouse IgG H&L (HRP) secondary antibodies (ZSGB-BIO, ZB-2301, 1:10000; ZB-2305, 1:10000, China), and images were taken using a ChemiDoc XRS + Gel Imaging System (Bio-Rad, USA) and quantified using Image J.

CYP2E1 activity assay

CYP2E1 enzyme activity was determined using total and mitochondrial proteins extracted from myocardial tissues. The assay utilized the conversion of 7-hydroxy-4-trifluoromethylcoumarin (HFC) via CYP2E1 catalysis, with fluorescence detected with 410 nm for excitation and 538 nm for emission. The reaction was performed with and without diethyldithiocarbamate (DDTC), a specific CYP2E1 inhibitor. Using a standard curve, the HFC concentration in the samples was determined, and CYP2E1 activity was calculated as nmol/mg/min.

Histological analysis

Cardiac tissues were preserved in 4% formaldehyde and paraffin embedded. After cut into 4–6 μm slices using a microtome, tissues were stained with hematoxylin and eosin (H&E) or Masson’s trichrome, imaged using a slice scanner (Pannoramic 250 FLASH, 3DHIESTECH, Hungary), and analyzed using the CaseViewer software.

Immunofluorescence

Paraffin-embedded cardiac tissue sections were obtained using standard pathological procedures [40]. After dewaxing, rehydration, and epitope unmasking, sections were blocked (ZSGB-BIO, ZLI-9056, China) and overnight at 4 °C with antibodies against ATP5A (Abcam, ab14748, 1:150, UK), CYP2E1 (Invitrogen, PA5-50945, 1:150, USA), and Rhodamine Phalloidin (Invitrogen, R415, 1:50, USA). Following four PBS washes, sampled were incubated with Alexa 488-conjugated goat anti-mouse IgG (Invitrogen, A11029, 1:200) and cyanine5-conjugated goat anti-rabbit IgG, (Invitrogen, A10523, 1:200) for 1 h at room temperature and dual stained with DAPI (ZSGB-BIO, ZLI-95557, China). Images were acquired using a 63x oil immersion lens on a two-photon microscope (TCS SP8 DIVE, Leica, Germany) and analyzed with ImarisViewer 9.7.0.

For wheat germ agglutinin (WGA) staining, samples were blocked and incubated with Oregon Green 488-conjugated WGA antibodies (Invitrogen, W7024, 1:150, USA) overnight at 4 ℃. After four PBS washes, they were dual stained with DAPI. Images were acquired using a slice scanner (Pannoramic 250 FLASH, 3DHIESTECH, Hungary) and analyzed with CaseViewer software.

RNA-seq analysis

Total RNA was extracted from cardiac tissues using TRIzol (Ambion, 15596018, USA) per recommended procedures. RNAs with A260/A280 of 1.8–2.0 were selected for sequencing on an DNBSEQ-T7 platform. The RNA libraries were sequenced by OE Biotech, Inc (Shanghai, China). Clean reads were processed based on the following criteria: (1) removal of adapter-containing reads, (2) exclusion of reads with more than 1% unidentifiable bases, and (3) elimination of low-quality reads. The processed data were mapped using HISAT2 to the rat reference genome. Differentially expressed genes (DEGs) were identified with DESeq2 based on P < 0.05 and a fold change > 2 or < 0.5 and analyzed for Gene Ontology (GO) and KEGG pathway enrichment using the Metascape. Significant enrichment terms were visualized through column, chord, and bubble diagrams created in R(v3.2.0).

CYP2E1 overexpression cell line establishment

Rat cardiomyocyte cell line H9c2(2-1) (1101RAT-PUMC000219) was purchased from Cell Resource Center, CAMS/PUMC (Beijing, China) and was cultivated in high-glucose DMEM (Gibco, C11995500BT, USA) containing 10% fetal bovine serum (Gibco, 11995065, USA), 100 U/ml penicillin, and 100 g/ml streptomycin (Gibco, 15070063, USA) at 37 °C with 5% CO2 and 95% air and passaged after trypsin (Solarbio, T1320, China) digestion. A Cyp2e1 expression vector was prepared by inserting full-length Rattus norvegicus Cyp2e1 cDNA into the pcDNA3.1 with a flag tag and introduced into H9c2(2-1) cells using Lipofectamine 2000 (Thermo Fisher, 11668019, USA). Stable overexpression cell lines were established through puromycin (1 µg/ml, Sigma, P8833, USA).

Interactive molecular screening and LC-MS/MS

Cells transfected with pcDNA3.1 and Flag-CYP2E1 constructs were collected and lysed. Immunoprecipitation (IP) was performed using a CYP2E1 antibody, with rabbit IgG serving as a negative control. The immunoprecipitants were subjected to LC-MS/MS analysis conducted by Jiyun Biotech Co., Ltd (Shanghai, China). Substrate proteins interacting with CYP2E1 were identified based on protein scores and detected mass values.

Coimmunoprecipitation (Co-IP) assay

Myocardial tissue from CYP2E1 overexpression rats was dissolved in an IP lysis buffer (Thermo Fisher, 78505, USA) on ice for 30 min and spun at 13,000 rpm for 30 min at 4 ℃. The supernatant was incubated with 2 µg antibodies against CYP2E1 (Abcam, ab19140, UK) or OPA1 (ABclonal, A9833, China) antibody overnight at 4 ℃ under rotation and supplied with 30 µl of protein A/G agarose beads (Thermo Fisher, 20421, USA). After incubation overnight at 4 ℃ with gentle rotation, beads were gathered after spinning at 3000 rpm for 3 min at 4 °C and washed 3 times with protein extraction reagent. The bound immune complexes were dissolved in 1×SDS-PAGE sample solution and examined using Western blot.

TUNEL assay

Apoptotic cells were examined using in situ terminal dUTP nick end-labeling (TUNEL) assay according to the supplier’s protocol (Merck, S7111, USA). Cardiac tissue paraffin sections were dewaxed and rehydrated before pretreatment with protease K (20 µg/ml) at room temperature for 15 min. After two PBS washes, samples were equilibrated with the provided buffer for over 10 s, incubated with the working-strength TdT enzyme in a humidified cell at 37 °C for 1 h, and treated with stop/wash solution under gentle agitation for 10 min. After PBS wash, the sections were mounted using an antifade mounting solution containing DAPI (Beyotime, P0131, China) on a slide, imaged using a slice scanner (Pannoramic 250 FLASH, 3DHIESTECH, Hungary), and analyzed with CaseViewer software.

Transmission electron microscopy (TEM)

Heart and isolated myocardial tissues were preserved in 2.5% glutaraldehyde at 4 ℃ for more than 2 h, followed by three PBS washes for 10 min and a second fixation in 1% osmic acid at 4 ℃ for 2 h. After three washes with ddH2O for 10 min, tissues underwent ethanol gradient dehydration and were infiltrated with serious mixtures with decreased propylene oxide to EPON 812 resin ratio before embedding in pure EPON 812 resin. Semithin Sect. (900 nm) were cut to identify regions of interest under light microscopy, and ultrathin Sect. (90 nm) were subsequently prepared and mounted on 300-mesh copper grids. For double-labeled immunoelectron microscopy (IEM), girds were incubated with 1% goat serum before with primary antibodies (CYP2E1 and OPA1) overnight at 4 °C and secondary antibodies labeled with colloidal gold (10 nm and 35 nm) for 1 h at room temperature. Sections were fixed with 1% glutaraldehyde, stained with uranyl acetate and lead citrate, and imaged using a JEM-1400 transmission electron microscope (JEOL, Japan).

Detection of mitochondrial complex activity

The mitochondrial respiratory chain activity kits (Solarbio, BC3235, BC0515, China) were used to detect the activity of Complex I and Complex II in the left ventricular myocardial tissue of rats. Add 1 mL extraction liquid to 50 mg tissue and homogenate using the Dounce tissue grinder. Centrifuge at 600 g (4℃) for 10 min, collect the supernatant and then centrifuge at 11,000 g (4℃) for 15 min. Then, precipitation was obtained after adding appropriate amount of extraction liquid. Finally, the absorbance of 340 nm (Complex I) and 605 nm (Complex II) was detected, respectively, and the activity of the complex was calculated according to the instructions.

Detection of ROS

First, ROS was detected by the fluorescent probe Dihydroethidium (DHE). Frozen cardiac tissues sections incubated with 20 µM DHE dye at 37 C for 30 min. Section were then counterstained with DAPI. Images of sections were captured by slice scanner. All sections were analyzed using the CaseViewer image viewing software. Then, ROS was also detected by ELISA. An appropriate volume of saline was added into the rat left ventricular myocardial tissue and homogenized, centrifuge 1000 g for 10 min and retain the supernatant. The diluted sample and biotin antibody labeling kit were added into the reaction well and then incubated at 37 ℃ for 1 h. Discard the liquid from the well and washed. Add 50 µl HRP-streptavidin to each well, then incubated at 37 ℃ for 30 min, discarded the liquid and washed for 3 times. After the substrate was added and incubated at 37 ℃ for 10 min, the reaction was terminated immediately, and the optical density at 450 nm was measured.

Statistical analysis

Data are presented as means ± standard error of the mean (SEM) and compared using unpaired two-tailed Student’s t-tests or one-way analysis of variance (ANOVA) with Tukey’s correction with GraphPad Prism software (version 9.5, San Diego, CA, USA). P < 0.05 was deemed as statistical significance.

Results

CYP2E1 is specifically upregulated in the mitochondria of myocardial tissue in various heart diseases

Analysis of the GSE116250 dataset from GEO revealed augmented CYP2E1 expression in left ventricular myocardial tissue from clinical DCM and ischemic ICM samples (Fig. 1A). Consistent with these findings, previous studies also demonstrated CYP2E1 upregulation in HCM samples [7]. We further confirmed upregulation of CYP2E1 expression in multiple well-established animal models of myocardial injury, cardiomyopathy, and heart failure (HF), including left anterior descending coronary artery (LAD) ligation-induced ischemia, transverse aortic constriction (TAC)-induced myocardial hypertrophy/HF, DXR-induced myocardial injury, and transgenic familial DCM (LMNAE82K) [7, 29] and additional animal models established in this study, including DXR-induced myocardial injury rat model, angiotensin II (ANG II) or ISO-induced myocardial hypertrophy rat model, cTnTR92Q transgenic and cTnTR141W transgenic familiar HCM mouse models (Fig. 1B, C). Furthermore, myocardial injury markers in these models were similarly verified (Fig. S1A, B), supporting the role of CYP2E1 as a sensor of diverse myocardial pathological states. Interestingly, mitochondrial extracts from these models consistently showed a 143−244% increase in CYP2E1 expression, compared to a 52–117% increase in total protein extracts (Fig. 1C, D). The proportion of CYP2E1 upregulation in mitochondrial extracts was significantly higher than in total protein extracts (Fig. 1E). Mitochondrial extract purity was validated (Fig. S1C, D). Consistently, enzyme activity of CYP2E1 in the cTnTR141W transgenic DCM mouse model mirrored its protein expression trends (Fig. S1E). Additionally, microsome extracts from DXR-induced myocardial injury and cTnTR141W transgenic DCM models showed elevated CYP2E1 levels, though the mitochondrial proportion of increase remained significantly higher (Fig. S1F, G, H). Microsome extract purity was validated (Fig. S1C, D). Immunofluorescence analysis further revealed that CYP2E1 localization in mitochondria increased under pathological stimulation in DXR- and ISO-induced models (Fig. 1F), corroborating Western blot results. These findings highlight the mitochondrial-specific upregulation of CYP2E1 in myocardial pathologies.

Establishment of myocardium-specific CYP2E1 animal models

To investigate the significance of mitochondrial CYP2E1 upregulation in myocardial diseases and its systemic impact, myocardium-specific CYP2E1 knockout (Cyp2e1-KO) and overexpression (Cyp2e1-OV) rat models were developed (Fig. 2A), These precision animal models provide essential tools for understanding CYP2E1’s biological role in myocardial injury and cardiomyopathy progression.

Fig. 2
figure 2

Establishment of myocardium-specific Cyp2e1 overexpression and knockout rats. (A) Experimental strategy for generating myocardium-specific CYP2E1 tool rats. (B-C) generating of conditional Cyp2e1 knockout (Cyp2e1 cKO) rats using the Cre-loxP recombination system. Crossbreeding with α-MHC-Cre rats produced myocardium-specific CYP2E1 knockout rats (Cyp2e1-KO; Cyp2e1flox/flox/α-MHC-Cre). LA: left arm; RA: right arm. (D-E) Immunoblotting of CYP2E1 in cardiac tissues from Cyp2e1-KO rats to assess knockout efficiency. Quantitative analysis normalized to GAPDH. (F) Strategy for constructing myocardium-specific CYP2E1 overexpression rats (Cyp2e1-OV using a-MHC (a-myosin heavy chain)-driven transgene expression. (G) Generation of Cyp2e1-OV rats through crossing with SD wild-type rats. (H-J) Validation of CYP2E1 overexpression efficiency in total and mitochondrial protein extracts from Cyp2e1-OV cardiac tissues via immunoblotting. Quantitative analysis was normalized to GAPDH or VDAC1. Data shown are mean ± SEM; n = 9 per group. Two-group comparisons were executed using unpaired two-tailed Student’s t-tests. **P < 0.01, ***P < 0.001

Full size image

Figure 2B showed the Cyp2e1-cKO rats, and Fig. 1C showed the α-MHC tool rats established previously [41]. Fig. S2A showed the genotyping results of Cyp2e1 cKO rats using PCR. After two cycles of crossbreeding, the mendelian ratio of Cyp2e1-KO rats is about 12.5%. Furthermore, Western blot analysis showed an efficient 74.48% reduction in CYP2E1 in the total heart extract of Cyp2e1-KO rats (Fig. 2D).

Cyp2e1-OV rats were established using a-MHC promoter (Fig. 2E). Among seven founders, the F015 line with high CYP2E1 expression was selected through PCR and Western blotting (Fig. S2B, C) and bred with SD wild-type rats (Fig. 2F). CYP2E1 protein levels in F015 myocardium increased 7.73-fold in total protein extracts and 11.98-fold in mitochondrial protein extracts, with a mitochondrial increase 1.46 times higher than the total protein increase (Fig. 2G, H, I, J). Microsomal CYP2E1 levels increased 6.97-fold, lower than the levels in total and mitochondrial extracts (Fig. S2D).

Both Cyp2e1-KO and Cyp2e1-OV rats exhibited no differences in survival, body weight, or general health compared to control rats at the ages of 1, 3, 7, and 15 months (Fig. S3A). Cardiac phenotypes showed no significant differences at 1 and 3 months. However, by 7 and 15 months, Cyp2e1-OV rats demonstrated reduced ventricular wall thickness, larger ventricular diameters, and decreased cardiac function, while Cyp2e1-KO rats exhibited increased wall thickness, smaller diameters, and improved cardiac function (Fig. S3B-J).

Systemic organ evaluation, including liver, spleen, lung, kidney, brain, skeletal muscle, and gonads, revealed no pathological differences among the groups, except for heart morphology changes that aligned with echocardiographic findings (Fig. S4A-D). Western blot analysis confirmed no significant CYP2E1 expression changes in other organs, highlighting heart-specific alterations (Fig. S4E).

CYP2E1 enhances susceptibility to myocardial injury under pathological stress

Given that CYP2E1 is abnormally elevated in various heart diseases, the myocardium-specific CYP2E1 animal models were analyzed for cardiac phenotypic changes under pathological stress. Pathological myocardial injury was induced DXR, followed by echocardiographic, histopathological, and molecular analyses (Fig. 3A). CYP2E1 overexpression exacerbated DXR-induced myocardial histopathological injury and functional impairment, whereas CYP2E1 knockout significantly alleviated these effects (Fig. 3).

Fig. 3
figure 3

CYP2E1 enhances susceptibility to pathological myocardial injury induced by DXR treatment. (A) Schematic diagram of pathological myocardial injury stimulation and experimental strategy in myocardium-specific Cyp2e1-KO and Cyp2e1-OV rats. (B) Transthoracic echocardiographic images (M-mode) of left ventricle (LV) morphology in six groups: control-saline (CON-saline), Cyp2e1-OV-saline (OV-saline), Cyp2e1-KO-saline (KO-saline), control-DXR (CON-DXR), Cyp2e1-OV-DXR (OV-DXR), and Cyp2e1-KO-DXR (KO-DXR). (C-J) Echocardiographic parameters, including LVPWs, LVPWd, LVAWs, LVAWd, LVIDs, LVIDd, ejection fraction, and fractional shortening, were analyzed across the six groups. Data shown are mean ± SEM; n = 8–12 rats per group. (K-L) Representative images of whole-heart transverse sections and magnified view of the left ventricle with H&E staining. Scale bars: blue = 5 mm; black = 40 μm. (M) Degree of fibrosis in myocardial tissue across the six groups, assessed by Masson trichrome staining. Scale bars: black = 40 μm. (N) Quantification of collagen area fraction in cardiomyocytes. Data shown are mean ± SEM; n = 3 rats and 18 fields per group. Multiple comparisons between groups were conducted using ANOVA with Tukey correction. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

Echocardiography revealed thinner ventricular walls, larger ventricular cavities, and decreased cardiac function in Cyp2e1-OV-DXR rats compared to control-DXR rats. Conversely, Cyp2e1-KO-DXR rats exhibited thicker anterior ventricular walls, smaller end-systolic diameters, and improved cardiac function (Fig. 3B-J; Table S1). Histopathological analysis showed that CYP2E1 overexpression worsened myocardial fiber disarray and myofilament rupture, while CYP2E1 knockout significantly mitigated these abnormalities (Fig. 3K, L). Masson’s trichrome staining revealed increased interstitial collagen accumulation in Cyp2e1-OV-DXR rat hearts, whereas Cyp2e1-KO-DXR rats demonstrated reduced fibrosis compared to control-DXR rats (Fig. 3M, N). These findings collectively indicate that CYP2E1 accelerates DXR-induced myocardial injury and associated structural and functional damage.

Isoproterenol (ISO) stimulation was used to simulate pathological cardiac hypertrophy, followed by similar analyses (Fig. 4A). CYP2E1 overexpression increased susceptibility to ISO-induced cardiac remodeling, while CYP2E1 knockout reduced responsiveness. High levels of CYP2E1 accelerated, whereas CYP2E1 knockout inhibited ISO-induced cardiac structural and functional remodeling (Fig. 4). Echocardiography showed thinner ventricular walls, larger ventricular cavities, and reduced cardiac function in Cyp2e1-OV-ISO rats compared to control-ISO rats. In contrast, Cyp2e1-KO-ISO rats exhibited improved cardiac function and morphological remodeling (Fig. 4B-J; Table S2). Histopathological analysis indicated greater myocardial fiber disarray and hypertrophy in Cyp2e1-OV-ISO rats, while Cyp2e1-KO-ISO rats displayed significant improvement (Fig. 4K, L). WGA staining unveiled a substantial increase in cardiomyocyte cross-sectional area in Cyp2e1-OV-ISO rats, indicating exacerbated hypertrophy. In contrast, Cyp2e1-KO-ISO rats exhibited reduced hypertrophy compared to control-ISO rats (Fig. 4M, N). These findings demonstrate that CYP2E1 promotes the decompensation process in pathological cardiac hypertrophy.

Fig. 4
figure 4

CYP2E1 enhances susceptibility to pathological cardiac remodeling induced by ISO treatment. (A) Schematic representation of pathological cardiac hypertrophy stimulation and the experimental strategy in myocardium-specific Cyp2e1-KO and Cyp2e1-OV rats. (B) Transthoracic echocardiographic images (M-mode) illustrating left ventricle (LV) morphology in six groups: control-saline, Cyp2e1-OV-saline, Cyp2e1-KO-saline, control-ISO, Cyp2e1-OV-ISO (OV-ISO), and Cyp2e1-KO-ISO (KO-ISO). (C-J) Echocardiographic parameters, including LVPWs, LVPWd, LVAWs, LVAWd, LVIDs, LVIDd, ejection fraction, and fractional shortening, were analyzed across the six groups. Data are presented as mean ± SEM; n = 6–13 rats per group. (K-L) Representative images of whole-heart transverse sections and magnified view of the left ventricle with H&E staining. scale bars: blue = 5 mm; black = 40 μm. (M) Myocardial fiber morphology in myocardial tissue was assessed using immunofluorescence staining with wheat germ agglutinin (green). Paraffin sections were imaged using a confocal microscope. DAPI (blue) indicates nuclei. Scale bars: white = 40 μm. (N) Quantification of cross-sectional cardiomyocyte area across the six groups. Data shown are mean ± SEM; n = 3 rats and 54 cardiomyocytes per group. Multiple comparisons between groups were executed using ANOVA with Tukey correction. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

Overall, high CYP2E1 levels worsen, while CYP2E1 knockout inhibits pathological myocardial remodeling and injury processes. These results highlight CYP2E1 as a critical factor in myocardial susceptibility to pathological stress.

CYP2E1 influences mitochondrial metabolism and apoptosis in myocardium

Building on the observation that CYP2E1 is significantly upregulated in the mitochondria of myocardial tissue during heart disease (Fig. 1), further investigations explored its role in regulating myocardial pathological processes. The hypothesis that CYP2E1 modulates myocardial pathologies via mitochondrial biological processes was tested through transcriptomic and proteomic analyses using CYP2E1-specific animal models and stable H9c2 cell lines overexpressing Flag-CYP2E1 (Fig. 5A; Fig. S5A, B). RNA sequencing revealed that CYP2E1 affects hundreds of genes. In Cyp2e1-KO-DXR rats compared to control-DXR rats, 99 genes were overexpressed, and 223 were underexpressed. Similarly, in Cyp2e1-OV-DXR rats, 108 genes were overexpressed, and 209 were underexpressed (Fig. 5B; Supplementary data 4). These differentially expressed genes (DEGs) mainly involved in myocardial injury (Sln, Bmp10, Ahsg, Myl4, Myl7, Mybphl, and Pcp4), mitochondrial-related metabolism (Cyp27b1, Drd1, Nox4, Ripk3, Lfit3, and Atp1a3) and apoptosis (Ddx3, Rag1, Bmp7, and Clspn) (Fig. 5C; Supplementary data 4). GO annotations revealed enrichment in positive regulation of apoptosis, ventricular system development, cell morphogenesis, and regulation of membrane potential (Fig. 5D; Supplementary data 4 ). Affinity purification with LC-MS/MS analysis identified 429 proteins significantly influenced by CYP2E1. GO annotations highlighted the enrichment of cellular components such as membrane rafts and microdomains. Molecular function and biological process analysis revealed they were enriched in actin cytoskeleton organization, negative regulation of cellular component organization, cell division, cellular component assembly involved in morphogenesis, and regulation of cellular component size (Fig. 5E; Supplementary data 5). These findings confirmed that CYP2E1 significantly impacts myocardial injury, mitochondrial-related metabolism, and apoptosis.

Fig. 5
figure 5

CYP2E1 expression affects myocardial injury, mitochondrial metabolism, and myocardial apoptosis under DXR stimulation. (A) Experimental strategy for transcriptomic analysis and protein interaction mass spectrometry using myocardium-specific CYP2E1 animal models and stable H9c2 cell lines with high expression of Flag-CYP2E1. (B) Transcriptomic analysis of myocardium from Cyp2e1-KO or Cyp2e1-OV rats. Volcano plot shows up-regulated (pink) and down-regulated (green) genes. The x-axis represents log2fold-change, indicating the direction of gene expression changes (negative for downregulation, and positive for upregulation). The y-axis illustrates the negative log of the FDR-adjusted p-value, indicating the significance of changes. (C) Heatmap of differentially expressed genes involved in cardiomyopathy, mitochondrial metabolism, and apoptosis. (D) Enrichment analysis of RNA sequencing data, highlighting enriched pathways. Bubble color indicates significance, while bubble size corresponds to the number of DEGs in each pathway. (E) Enrichment analysis of CYP2E1-bound proteins identified by mass spectrometry following CYP2E1 immunoprecipitation. Key gene ontology terms and KEGG pathways are displayed and categorized into biological process, cellular component, molecular function, and KEGG pathway.

Full size image

CYP2E1 participates in pathological process of myocardial injury through imbalanced mitochondrial OPA1 processing

To explore how CYP2E1 regulates myocardial injury, we first confirmed its expression in myocardial tissues from different animal groups (Control-saline, Cyp2e1-OV-saline, Cyp2e1-KO-saline, Control-DXR, Cyp2e1-OV-DXR, and Cyp2e1-KO-DXR) (Fig. S5C). Using only cardiac samples from the control-DXR, Cyp2e1-OV-DXR, and Cyp2e1-KO-DXR groups, we investigated how CYP2E1 affects mitochondrial biological processes during pathological stress (Fig. 6A).

Fig. 6
figure 6

CYP2E1 expression affects the morphology and function of mitochondria under DXR stimulation. (A) Schematic diagram illustrating the experimental strategy to analyze the role of CYP2E1 in mitochondrial morphology and OPA1 processing in myocardium-specific Cyp2e1-KO and Cyp2e1-OV rats under pathological myocardial injury. (B) TEM images of myocardium from control-DXR (CON-DXR), Cyp2e1-OV-DXR (OV-DXR), and Cyp2e1-KO-DXR (KO-DXR) groups. Blue and purple arrowheads indicate smaller and elongated mitochondria, respectively. (C-D) Histogram and violin plot presenting the frequency distribution and median surface area of mitochondria across the three groups (49–67 mitochondria were analyzed per group). CSA, cell cross-sectional area. (E-G) Levels of CYP2E1 proteins, phosphorylated Drp1 (phosphor-Drp1) at Ser616 and Ser637), and Drp1 translocation (mitochondria and cytoplasm) were quantified via immunoblotting and standardized to GAPDH or VDAC1. Data shown are mean ± SEM; n = 4–6 per groups. (H-I) Activity of mitochondrial Complex I and mitochondrial Complex II. Data shown are mean ± SEM; n = 4–7 per groups. (J-K) Levels of NDUFS1, SDHA, SDHB and CYTB were quantified via immunoblotting, and standardized to GAPDH. Data shown are mean ± SEM; n = 4–6 per groups. Multiple comparisons between groups were analyzed using ANOVA with Tukey correction. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

TEM revealed that CYP2E1 overexpression caused smaller, fragmented mitochondria in the Cyp2e1-OV-DXR group. The frequency distribution of mitochondrial surface area and median surface area were significantly reduced, indicating worsened fragmentation compared to control-DXR rats (Fig. 6B-D). In contrast, Cyp2e1-KO-DXR treatment resulted in larger mitochondria and enhanced mitochondrial fusion, suggesting a protective effect against fragmentation (Fig. 6B-D). No significant differences were noted among the saline-treated groups (Fig. S5D-F).

The TEM results, alongside omics data, suggested that CYP2E1 might regulate mitochondrial fission and fusion. We next investigated the translocation of Drp1, an essential protein for mitochondrial fission. CYP2E1 overexpression promoted Drp1 translocation from the cytoplasm to the mitochondria and phosphorylation at Ser616 while decreasing phosphorylation at Ser637 (Fig. 6E-G). This observation aligned with the mitochondrial fragmentation seen in Cyp2e1-OV-DXR and Cyp2e1- KO-DXR rats.

Moreover, we observed the effect of CYP2E1 on mitochondrial function from myocardial tissue in vivo, including the activity detection of complex I and complex II, and the detection of molecular expression levels of mitochondrial markers reflecting mitochondrial function. These include NDUFS1 (Marker molecular of mitochondrial complex I), SDHA and SDHB (Marker of mitochondrial complex II), and CYTB (Marker of mitochondrial complex III). The results suggest that high level of CYP2E1 can increase mitochondrial function damage in vivo stimulated by DXR (Fig. 6H-K).

Then, we further observed the effect of CYP2E1 on mitochondrial morphology using stable H9c2 cell lines overexpressing Flag-CYP2E1 in vitro. The mitochondrial fragmentation in H9C2 cells with high CYP2E1 expression tended to increase, but the mitochondrial diameter was not statistically significant (Fig. S5G-H). Meanwhile, we detected the expression of molecules marker reflecting mitochondrial function, including NDUFS1 and CYTB. The results showed that, high expression of CYP2E1 could significantly reduce the expression level of the above molecules, suggesting that CYP2E1 can also impair mitochondrial function when stimulated by DXR in vitro (Fig. S5I-J).

To explore how CYP2E1 affects mitochondrial fission and fusion, we identified potential interacting proteins in the myocardium using immunoprecipitation in Cyp2e1-OV- DXR rats. Our results confirmed that CYP2E1 interacts with OPA1, a key protein regulating mitochondrial fusion (Fig. 7A). Immunoelectron microscopy revealed colocalization of CYP2E1 and OPA1 in the inner mitochondrial membrane, suggesting an interaction between them under DXR stress (Fig. 7B).

Fig. 7
figure 7

CYP2E1 participates in myocardial injury through imbalanced mitochondrial OPA1 processing. (A) Interaction between CYP2E1 and OPA1 in myocardium from the OV-DXR group was confirmed using reciprocal Co-IP assays. (B) Immunoelectron microscopy of rat myocardium from the control-DXR (CON-DXR) group. Yellow and blue arrowheads indicate CYP2E1 and OPA1 localization, respectively. Scale bars: 200 nm. (C-D) Protein levels in total, cytoplasmic, and mitochondrial extracts from the three groups were analyzed via immunoblotting. Assessed proteins included mitochondrial OPA1, cytoplasmic cytochrome c, procaspase-3, and activated caspase-3. GAPDH, β-actin, or VDAC1 was employed for normalization. Data shown are mean ± SEM (n = 4–6 per group). (E-F) Fluorescence microscopic images of DHE (red) using frozen sections of cardiac tissues from above 3 groups. DAPI (blue) was used to stain the cell nucleus. White bar = 50 μm. Data shown are mean ± SEM (n = 9 per group). (G) ROS levels in rat left ventricular myocardial tissue were measured by ELISA. Data shown are mean ± SEM (n = 8 per group). (H-I) Fluorescence microscopic images of TUNEL assay on paraffin sections of cardiac tissues from the three groups. Confocal imaging shows colocalization of TUNEL-positive nuclei (green) with DAPI (red), indicated by white arrows. Scale bars: 10 μm. Quantitative analysis of TUNEL-positive nuclei was conducted (n = 3 rats per group, n = 6 fields per rat). Multiple comparisons between groups were analyzed using ANOVA with Tukey correction. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

Further analysis of the effects of CYP2E1 on mitochondrial OPA1 processing showed that CYP2E1 overexpression reduced total OPA1 levels and decreased the proportion of long to short OPA1 isoforms, indicating an imbalance in OPA1 (Fig. 7C). This imbalance promotes mitochondrial dysfunction by facilitating the release of cytochrome c into the cytoplasm, activating the caspase cascade, and triggering oxidative stress and apoptosis (Fig. 7D-G). Ultimately, these changes contribute to cardiomyocyte apoptosis (Fig. 7H-I; Fig. S6). The above results indicated that CYP2E1 is crucial for myocardial injury by interfering with long and short OPA1 ratios, leading to mitochondrial fragmentation and initiating apoptosis.

Discussion

This study demonstrates that CYP2E1 exacerbates myocardial injury through imbalanced mitochondrial OPA1 processing, ultimately triggering mitochondrial fragmentation and apoptosis. The key findings of this research are as follows:

(i) CYP2E1 is upregulated in various heart diseases, with increased expression primarily localized in mitochondria. (ii) CYP2E1 is critically involved in the progression of DXR-induced cardiomyopathy and ISO-induced hypertrophic cardiomyopathy, where its upregulation worsens myocardial injury. (iii) CYP2E1 upregulation leads to mitochondrial fragmentation in the myocardium under DXR treatment. (iv) CYP2E1 and OPA1 colocalize in the inner mitochondrial membrane and interact with each other. CYP2E1 expression disrupts long and short OPA1 imbalance, triggering mitochondrial fragmentation and apoptosis, which contributes to cardiomyocyte death.

CYP2E1, a drug metabolism enzyme, has been implicated in obesity, diabetes, and liver diseases [9,10,11,12,13, 42,43,44,45]. Its expression is regulated by genetic factors, hormones, cytokines, xenobiotics, and pathological states [1, 2, 7, 8], suggesting it may act as a sensor for cellular damage and stress. Our study unveiled that CYP2E1 is upregulated in myocardial samples from various heart disease models, including clinical samples (e.g., HCM, DCM, ICM) and animal models of myocardial injury (e.g., LAD-induced ischemia mouse model, TAC-induced myocardial hypertrophy/HF mouse model, DXR-induced myocardial injury mouse and rat models, Ang II- and ISO-induced myocardial hypertrophy/HF rat models, LMNAE82K transgenic familiar DCM mouse model, cTnTR92Q transgenic familiar HCM mouse model, and cTnTR141W transgenic familiar DCM mouse model). These findings support the hypothesis that CYP2E1 acts as a sensor for multiple cardiac injuries [7, 29]. CYP2E1 mRNA is one of the most expressed CYP450 isoforms in human left ventricular myocardium [27], and polymorphisms in CYP2E1 significantly interact with polycyclic aromatic hydrocarbons to influence congenital heart diseases (CHDs) [28]. Previous studies also showed that CYP2E1 overexpression increases apoptosis in the myocardium, while its knockdown inhibits it [29, 30]. However, the precise molecular mechanisms by which CYP2E1 mediates apoptosis remain unclear. Therefore, we established genetically modified animal models, including myocardial tissue-specific CYP2E1 overexpression rats and CYP2E1 knockout rats, and subjected them to different pathological stimuli to explore its impacts on cardiac injury. In DXR-induced cardiotoxicity (DIC) models, we found that CYP2E1 overexpression exacerbated myocardial injury, while CYP2E1 deficiency ameliorated it. Similarly, in ISO-induced hypertrophic cardiomyopathy models, CYP2E1 overexpression increased susceptibility to cardiac hypertrophy and accelerated decompensation, whereas CYP2E1 deficiency reduced the response to ISO treatment and significantly alleviated myocardial remodeling. These findings suggest that CYP2E1 enhances the susceptibility to myocardial injury in response to multiple pathological stresses.

Interestingly, we also discovered that increased CYP2E1 was localized mainly in mitochondria, a finding not previously reported. This may offer new clues and potential targets for clinical interventions based on mitochondrial-dependent mechanisms for treating cardiovascular diseases. To explore whether CYP2E1’s regulation of myocardial injury involves mitochondrial biological processes, we conducted transcriptomic and CoIP combined mass spectrometry analyses in our models. These analyses revealed that CYP2E1 is related to myocardial injury, mitochondrial metabolism, and apoptosis. We also observed that high levels of CYP2E1 induced mitochondrial fragmentation in the myocardium under DXR-induced pathological stress, confirmed by both TEM observations and assessments of Drp1 translocation and phosphorylation. Omics analysis, TEM findings, and mitochondrial dynamics markers all suggested that CYP2E1 is involved in mitochondrial fission/fusion processes.

Further screening of potential CYP2E1-interacting proteins in the myocardium indicated that CYP2E1 and OPA1 colocalize in the inner mitochondrial membrane and interact with each other. Altered CYP2E1 expression in the myocardium with myocardial injury led to an imbalance between long and short OPA1 isoforms, ultimately triggering mitochondrial fragmentation and apoptosis (Fig. 8). This study helps clarify some of the mechanisms previously unclear in our prior research, which showed that CYP2E1 overexpression increases and its knockdown inhibits myocardial apoptosis [29, 30].

Fig. 8
figure 8

Unbalanced mitochondrial dynamics mediated by dysregulated CYP2E1 contributes to myocardial injury and heart failure. Dysregulated CYP2E1 expression in cardiomyocytes, induced by multiple factors, acts as a sensor of various pathophysiological conditions in the myocardium. Under pathological stimulation by DXR, CYP2E1 promotes mitochondrial fragmentation and the formation of smaller mitochondria, as demonstrated by TEM observations and analysis of Drp1 translocation and phosphorylation. CYP2E1 colocalizes with OPA1 in the inner mitochondrial membrane, where their interaction alters long and short OPA1 balance. This imbalance, mediated by CYP2E1, triggers mitochondrial fragmentation and mitochondria-dependent apoptosis, ultimately causing cardiomyocyte apoptosis and contributing to myocardial injury and heart failure

Full size image

CYP2E1 induces mitochondrial damage primarily through increased production of ROS and lipid peroxidation, impairing mitochondrial membrane permeability [6, 8, 14, 17, 20, 46,47,48,49]. Elevated mitochondrial CYP2E1 (mtCYP2E1) expression exacerbates cellular damage, potentially because mtCYP2E1 is more stable, resists proteasomal degradation, generates stronger ROS, and exerts a greater inhibitory effect on GSH [14, 21, 50]. While previous studies suggested that CYP2E1 contributes to mitochondrial damage via ROS accumulation, the exact mechanisms remained unclear. In this study, we demonstrated that CYP2E1 induces mitochondrial dynamic imbalance through direct interaction with mitochondrial machinery. CYP2E1 co-locates with OPA1 in the inner mitochondrial membrane and influences OPA1 processing. Changes in CYP2E1 expression disrupt long to short OPA1 ratio, triggering mitochondrial fragmentation, mitochondria-dependent apoptosis, and worsening pathological heart disease progression.

Historically, research on CYPs has focused on their role in drug metabolism, particularly in the liver [51]. However, emerging evidence shows that CYPs are expressed in various tissues and play significant regulatory roles [52, 53]. Over the last two decades, studies have unveiled the involvement of distinct CYP isoforms in cardiovascular homeostasis and heart diseases [54, 55]. CYPs are involved in the onset and advancement of heart disease by influencing ROS synthesis, lipid peroxidation, and the metabolism of cardiovascular drugs. Inhibitors and inducers targeting CYP activity have shown promise in treating conditions like myocardial ischemia and coronary heart disease [56, 57].

DXR, a chemotherapeutic agent used to treat solid tumors and hematologic malignancies, is associated with severe cardiotoxicity, including cardiomyopathy and congestive HF. Despite its clinical utility, effective treatments for DXR-induced cardiotoxicity remain limited, underscoring the need for further basic and clinical research. This study provides additional insights into potential therapeutic strategies targeting drug metabolism enzymes for heart disease.

Mitochondrial dynamics, including the balance between fission and fusion, are fundamental to maintaining mitochondrial function and cellular equilibrium. Imbalances in these processes can lead to cell death. Consequently, therapeutic strategies that inhibit pathological mitochondrial fission and promote mitochondrial fusion are promising for mitigating cardiac mitochondrial dysfunction. Approaches such as mitochondrial fission inhibitors and small interfering RNA (siRNA) targeting mitochondrial dynamics have shown preliminary efficacy in treating myocardial ischemia and HF [58,59,60,61].

Conclusions

Our study investigated the functions of CYP2E1 in DXR-induced cardiotoxicity/dilated cardiomyopathy and ISO-induced hypertrophic cardiomyopathy, highlighting its involvement in mitochondrial dynamic homeostasis. Elevated CYP2E1 expression exacerbates, while CYP2E1 knockout mitigates, the pathological progression of myocardial injury. The impact of CYP2E1 on mitochondrial OPA1 processing leads to mitochondrial fragmentation, mitochondria-dependent apoptosis, and eventual cardiomyocyte death. These findings advance our understanding of how drug metabolism enzymes influence the pathogenesis and progression of myocardial injury. Targeting the balance between mitochondrial fission and fusion by regulating genes associated with drug-metabolizing enzymes offers a promising therapeutic approach for myocardial injury, particularly in pathological conditions such as chemotherapy-induced cardiotoxicity.

Data availability

The sequencing data in this study has been deposited into the Sequence Read Archive (SRA) with accession number PRJNA1251851.

References

  1. Chen J, Jiang S, Wang J, Renukuntla J, Sirimulla S, Chen J. A comprehensive review of cytochrome P450 2E1 for xenobiotic metabolism. Drug Metab Rev. 2019;51(2):178–95.

    Article  CAS  PubMed  Google Scholar 

  2. Hartman JH, Miller GP, Meyer JN. Toxicological implications of mitochondrial localization of CYP2E1. Toxicol Res (Camb). 2017;6(3):273–89.

    Article  CAS  PubMed  Google Scholar 

  3. Chen C, Wang S, Yu L, Mueller J, Fortunato F, Rausch V, Mueller S. H(2)O(2)-mediated autophagy during ethanol metabolism. Redox Biol. 2021;46:102081.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Lu Y, Cederbaum AI. CYP2E1 potentiation of LPS and TNFalpha-induced hepatotoxicity by mechanisms involving enhanced oxidative and nitrosative stress, activation of MAP kinases, and mitochondrial dysfunction. Genes Nutr. 2010;5(2):149–67.

    Article  PubMed  Google Scholar 

  5. Massart J, Begriche K, Hartman JH, Fromenty B. Role of mitochondrial cytochrome P450 2E1 in healthy and diseased liver. Cells. 2022;11(2).

  6. Yu J, Zhu H, Kindy MS, Taheri S. Cytochrome P450 CYP2E1 suppression ameliorates cerebral ischemia reperfusion injury. Antioxid (Basel). 2021;10(1).

  7. Guan F, Yang X, Li J, Dong W, Zhang X, Liu N, Gao S, Wang J, Zhang L, Lu D. New molecular mechanism underlying Myc-Mediated cytochrome P450 2E1 upregulation in apoptosis and energy metabolism in the myocardium. J Am Heart Assoc. 2019;8(1):e009871.

    Article  CAS  PubMed  Google Scholar 

  8. Robertson LI, Farrell G. Nonalcoholic steatosis and steatohepatitis. II. Cytochrome P-450 enzymes and oxidative stress. Am J Physiol Gastrointest Liver Physiol. 2001;281(5):G1135–9.

    Article  CAS  PubMed  Google Scholar 

  9. Rasmussen MK, Bertholdt L, Gudiksen A, Pilegaard H, Knudsen JG. Impact of fasting followed by short-term exposure to interleukin-6 on cytochrome P450 mRNA in mice. Toxicol Lett. 2018;282:93–9.

    Article  CAS  PubMed  Google Scholar 

  10. Sarkozy M, Szucs G, Fekete V, Pipicz M, Eder K, Gaspar R, Soja A, Pipis J, Ferdinandy P, Csonka C, Csont T. Transcriptomic alterations in the heart of non-obese type 2 diabetic Goto-Kakizaki rats. Cardiovasc Diabetol. 2016;15(1):110.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Sun W, Dong H, Balaz M, Slyper M, Drokhlyansky E, Colleluori G, Giordano A, Kovanicova Z, Stefanicka P, Balazova L, Ding L, Husted AS, Rudofsky G, Ukropec J, Cinti S, Schwartz TW, Regev A, Wolfrum C. snRNA-seq reveals a subpopulation of adipocytes that regulates thermogenesis. Nature. 2020;587(7832):98–102.

    Article  CAS  PubMed  Google Scholar 

  12. Thogersen R, Kristensen CM, Olsen MA, Bertram HC, Pilegaard H. Rasmussen. Hepatic PGC-1alpha is not essential for fasting-induced cytochrome p450 regulation in mouse liver. Biochem Pharmacol. 2020;172:113736.

    Article  PubMed  Google Scholar 

  13. Zong H, Armoni M, Harel C, Karnieli E. Pessin. Cytochrome P-450 CYP2E1 knockout mice are protected against high-fat diet-induced obesity and insulin resistance. Am J Physiol Endocrinol Metab. 2012;302(5):E532–539.

    Article  CAS  PubMed  Google Scholar 

  14. Knockaert L, Fromenty B, Robin MA. Mechanisms of mitochondrial targeting of cytochrome P450 2E1: physiopathological role in liver injury and obesity. FEBS J. 2011;278(22):4252–60.

    Article  CAS  PubMed  Google Scholar 

  15. Neve EE, Pronzato EP, Albano MA, Marinari E, Ingelman-Sundberg U. Enzyme-specific transport of rat liver cytochrome P450 to the golgi apparatus. Arch Biochem Biophys. 1996;15(2):459–65.

    Article  Google Scholar 

  16. Neve EP, Ingelman-Sundberg M. Identification and characterization of a mitochondrial targeting signal in rat cytochrome P450 2E1 (CYP2E1). J Biol Chem. 2001;276(14):11317–22.

    Article  CAS  PubMed  Google Scholar 

  17. Raza PS, Robin H, Avadhani MA. Elevated mitochondrial cytochrome P450 2E1 and glutathione S-transferase A4-4 in streptozotocin-induced diabetic rats: tissue-specific variations and roles in oxidative stress. Diabetes. 2004;53(1):185–94.

    Article  CAS  PubMed  Google Scholar 

  18. Robin MA, Anandatheerthavarada HK, Fang JK, Cudic M, Otvos L. Avadhani. Mitochondrial targeted cytochrome P450 2E1 (P450 MT5) contains an intact N terminus and requires mitochondrial specific electron transfer proteins for activity. J Biol Chem. 2001;276(27):24680–9.

    Article  CAS  PubMed  Google Scholar 

  19. Son B, Kwon T, Lee S, Han I, Kim W, Youn H, Youn B. CYP2E1 regulates the development of radiation-induced pulmonary fibrosis via ER stress- and ROSdependent mechanisms. Am J Physiol Lung Cell Mol Physiol. 2017 Nov 1;313(5):L916-L929.

  20. Bai J, Cederbaum AI. Overexpression of CYP2E1 in mitochondria sensitizes HepG2 cells to the toxicity caused by depletion of glutathione. J Biol Chem. 2006;281(8):5128–36.

    Article  CAS  PubMed  Google Scholar 

  21. Bansal S, Liu CP, Sepuri NB, Anandatheerthavarada HK, Selvaraj V, Hoek J, Milne GL, Guengerich FP. Avadhani. Mitochondria-targeted cytochrome P450 2E1 induces oxidative damage and augments alcohol-mediated oxidative stress. J Biol Chem. 2010;285(32):24609–19.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Bhagwat BM, Ravindranath SV. Brain mitochondrial cytochromes P450: xenobiotic metabolism, presence of multiple forms and their selective inducibility. Arch Biochem Biophys. 1995;20(1):73–83.

    Article  Google Scholar 

  23. Knockaert L, Descatoire V, Vadrot N, Fromenty B, Robin MA. Mitochondrial CYP2E1 is sufficient to mediate oxidative stress and cytotoxicity induced by ethanol and acetaminophen. Toxicol Vitro. 2011;25(2):475–84.

    Article  CAS  Google Scholar 

  24. Murray B, Peng H, Barbier-Torres L, Robinson AE, Li TWH, Fan W, Tomasi ML, Gottlieb RA, Van Eyk J, Lu Z, Martinez-Chantar ML, Liangpunsakul S, Skill NJ, Mato JM, Lu SC. Methionine adenosyltransferase alpha1 is targeted to the mitochondrial matrix and interacts with cytochrome P450 2E1 to lower its expression. Hepatology. 2019;70(6):2018–34.

    Article  CAS  PubMed  Google Scholar 

  25. Bhagwat BM, Ravindranath SV. Multiple forms of cytochrome P450 and associated monooxygenase activities in human brain mitochondria. Biochem Pharmacol. 2000;59(1):573–82.

    Article  CAS  PubMed  Google Scholar 

  26. Tahrir FG, Langford D, Amini S, Mohseni Ahooyi T, Khalili K. Mitochondrial quality control in cardiac cells: mechanisms and role in cardiac cell injury and disease. J Cell Physiol. 2019;234(6):8122–33.

    Article  CAS  PubMed  Google Scholar 

  27. Michaud V, Frappier M, Dumas MC, Turgeon J. Metabolic activity and mRNA levels of human cardiac CYP450s involved in drug metabolism. PLoS ONE. 2010;5(12):e15666.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Li MY, Liu N, Deng Z, Guo Y, Zhang Y, Li X, Yu X, Wang P, Zhu Y. Assessment of interaction between maternal polycyclic aromatic hydrocarbons exposure and genetic polymorphisms on the risk of congenital heart diseases. Sci Rep. 2018;15(1):3075.

    Article  Google Scholar 

  29. Lu D, Ma Y, Zhang W, Bao D, Dong W, Lian H, Huang L, Zhang L. Knockdown of cytochrome P450 2E1 inhibits oxidative stress and apoptosis in the cTnT(R141W) dilated cardiomyopathy Transgenic mice. Hypertension. 2012;60(1):81–9.

    Article  CAS  PubMed  Google Scholar 

  30. Zhang W, Lu D, Dong W, Zhang L, Zhang X, Quan X, Ma C, Lian H, Zhang L. Expression of CYP2E1 increases oxidative stress and induces apoptosis of cardiomyocytes in Transgenic mice. FEBS J. 2011;278(9):1484–92.

    Article  CAS  PubMed  Google Scholar 

  31. Ma Y, Zhang X, Shen B, Lu Y, Chen W, Ma J, Bai L, Huang X, Zhang L. Generating rats with conditional alleles using CRISPR/Cas9. Cell Res. 2014;24(1):122–5.

    Article  CAS  PubMed  Google Scholar 

  32. Lu D, Wang J, Li J, Guan F, Zhang X, Dong W, Liu N, Gao S, Zhang L. Meox1 accelerates myocardial hypertrophic decompensation through Gata4. Cardiovasc Res. 2018;114(2):300–11.

    Article  CAS  PubMed  Google Scholar 

  33. Juan F, Wei D, Xiongzhi Q, Ran D, Chunmei M, Lan H, Chuan Q, Lianfeng Z. The changes of the cardiac structure and function in cTnTR141W Transgenic mice. Int J Cardiol. 2008;128(1):83–90.

    Article  PubMed  Google Scholar 

  34. Ling Y, Ma J, Qi X, Zhang X, Kong Q, Guan F, Dong W, Chen W, Gao S, Gao X, Pan S, Ma Y, Lu D, Zhang L. Novel rat model of multiple mitochondrial dysfunction syndromes (MMDS) complicated with cardiomyopathy. Anim Model Exp Med. 2021;4(4):381–90.

    Article  CAS  Google Scholar 

  35. Wu TT, Ma YW, Zhang X, Dong W, Gao S, Wang JZ, Zhang LF, Lu D. Myocardial tissue-specific Dnmt1 knockout in rats protects against pathological injury induced by adriamycin. Lab Invest. 2020;100(7):974–85.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Mohammed SA, Paramesha B, Kumar Y, Tariq U, Arava SK. Banerjee. Allylmethylsulfide, a sulfur compound derived from Garlic, attenuates Isoproterenol-Induced cardiac hypertrophy in rats. Oxid Med Cell Longev. 2020;2020:7856318.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Jiang XY, Guan FF, Ma JX, Dong W, Qi XL, Zhang X, Chen W, Gao S, Gao X, Pan S, Wang JZ, Ma YW, Zhang LF, Lu D. Cardiac-specific Trim44 knockout in rat attenuates isoproterenol-induced cardiac remodeling via Inhibition of AKT/mTOR pathway. Dis Model Mech. 2023;16(5).

  38. Sharma RK, Yang T, Oliveira AC, Lobaton GO, Aquino V, Kim S, Richards EM, Pepine CJ, Sumners C. Raizada. Microglial cells impact gut microbiota and gut pathology in angiotensin II-Induced hypertension. Circ Res. 2019;124(5):727–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Ling Y, Yang X, Zhang X, Guan F, Qi X, Dong W, Liu M, Ma J, Jiang X, Gao K, Li J, Chen W, Gao S, Gao X, Pan S, Wang J, Ma Y, Lu D, Zhang L. Myocardium-specific Isca1 knockout causes iron metabolism disorder and myocardial oncosis in rat. Life Sci. 2022;297:120485.

    Article  CAS  PubMed  Google Scholar 

  40. Tan QX, Kong L, Jin W, Lu J, Zhang D, Wang X, Wang Y, Dong S, Shi W, Chen X, Wang W, Li J, Xie K, Gao Y, Guan L, Gao F, Li K, Wang C, Hu C, Zhang Z, Guo L, Shen X, Ma B. Y. A conditional knockout rat resource of mitochondrial protein-coding genes via a DdCBE-induced premature stop codon. Sci Adv. 2023;14;9(15):eadf2695.

  41. Ma Y, Yu L, Pan S, Gao S, Chen W, Zhang X, Dong W, Li J, Zhou R, Huang L, Han Y, Bai L, Zhang L, Zhang L. CRISPR/Cas9-mediated targeting of the Rosa26 locus produces Cre reporter rat strains for monitoring Cre-loxP-mediated lineage tracing. FEBS J. 2017;284(19):3262–77.

    Article  CAS  PubMed  Google Scholar 

  42. Caro AA, Cederbaum AI. Oxidative stress, toxicology, and Pharmacology of CYP2E1. Annu Rev Pharmacol Toxicol. 2004;44:27–42.

    Article  CAS  PubMed  Google Scholar 

  43. Gonzalez FJ. Role of cytochromes P450 in chemical toxicity and oxidative stress: studies with CYP2E1. Mutat Res. 2005;569(1–2):101–10.

    Article  CAS  PubMed  Google Scholar 

  44. Shahabi HN, Andersson DR, Nissbrandt H. Cytochrome P450 2E1 in the substantia Nigra: relevance for dopaminergic neurotransmission and free radical production. Synapse. 2008;62(5):379–88.

    Article  CAS  PubMed  Google Scholar 

  45. Zhang F, Yu X, He C, Ouyang X, Wu J, Li J, Zhang J, Duan X, Wan Y, Yue J. Effects of sexually dimorphic growth hormone secretory patterns on arachidonic acid metabolizing enzymes in rodent heart. Toxicol Appl Pharmacol. 2015;289(3):495–506.

    Article  CAS  PubMed  Google Scholar 

  46. Angireddy R, Chowdhury AR, Zielonka J, Ruthel G, Kalyanaraman B. Avadhani. Alcohol-induced CYP2E1, mitochondrial dynamics and retrograde signaling in human hepatic 3D organoids. Free Radic Biol Med. 2020;159:1–14.

    Article  CAS  PubMed  Google Scholar 

  47. Puccinelli E, Gervasi PG, Pelosi G, Puntoni M, Longo V. Modulation of cytochrome P450 enzymes in response to continuous or intermittent high-fat diet in pigs. Xenobiotica. 2013;43(8):686–98.

    Article  CAS  PubMed  Google Scholar 

  48. Sakurai CA. Oxidative stress and cytotoxicity induced by ferric-nitrilotriacetate in HepG2 cells that express cytochrome P450 2E1. Mol Pharmacol. 1998;54(6):1024–35.

    Article  CAS  PubMed  Google Scholar 

  49. Zhao MG, Sheng XP, Huang YP, Wang YT, Jiang CH, Zhang J. Yin. Triterpenic acids-enriched fraction from cyclocarya paliurus attenuates non-alcoholic fatty liver disease via improving oxidative stress and mitochondrial dysfunction. Biomed Pharmacother. 2018;104:229–39.

    Article  CAS  PubMed  Google Scholar 

  50. Bansal S, Srinivasan S, Anandasadagopan S, Chowdhury AR, Selvaraj V, Kalyanaraman B, Joseph J, Avadhani NG. Additive effects of mitochondrion-targeted cytochrome CYP2E1 and alcohol toxicity on cytochrome C oxidase function and stability of respirosome complexes. J Biol Chem. 2012;287(19):15284–97.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Xuan J, Chen S, Ning B, Tolleson WH, Guo L. Development of HepG2-derived cells expressing cytochrome P450s for assessing metabolism-associated drug-induced liver toxicity. Chem Biol Interact. 2016;255:63–73.

    Article  CAS  PubMed  Google Scholar 

  52. Wei Y, Wang D, Chen M, Ouyang Z, Wang S, Gu J. Extrahepatic cytochrome P450s play an insignificant role in triptolide-induced toxicity. Chin Med. 2018;13:23.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Burkina V, Rasmussen MK, Pilipenko N, Zamaratskaia G. Comparison of xenobiotic-metabolising human, Porcine, rodent, and piscine cytochrome P450. Toxicology. 2017;375:10–27.

    Article  CAS  PubMed  Google Scholar 

  54. ElKhatib MAW, Isse FA, El-Kadi AOS. Effect of inflammation on cytochrome P450-mediated arachidonic acid metabolism and the consequences on cardiac hypertrophy. Drug Metab Rev. 2023;55(1–2):50–74.

    Article  CAS  PubMed  Google Scholar 

  55. Nayeem MA, Hanif A, Geldenhuys WJ, Agba S. Crosstalk between adenosine receptors and CYP450-derived Oxylipins in the modulation of cardiovascular, including coronary reactive hyperemic response. Pharmacol Ther. 2022;240:108213.

    Article  CAS  PubMed  Google Scholar 

  56. Ellithi BJ, Wilke M. CYP2C19 genotype-guided antiplatelet therapy: promises and pitfalls. Pharmacogenomics Pharmacogenomics. 2020;21(12):889–97.

    Article  CAS  PubMed  Google Scholar 

  57. Xu X, Zhang XA, Wang DW. The roles of CYP450 epoxygenases and metabolites, epoxyeicosatrienoic acids, in cardiovascular and malignant diseases. Adv Drug Deliv Rev. 2011;63(8):597–609.

    Article  CAS  PubMed  Google Scholar 

  58. Duan C, Wang L, Zhang J, Xiang X, Wu Y, Zhang Z, Li Q, Tian K, Xue M, Liu L, Li T. Mdivi-1 attenuates oxidative stress and exerts vascular protection in ischemic/hypoxic injury by a mechanism independent of Drp1 GTPase activity. Redox Biol. 2020;37:101706.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Sharp WW, Fang YH, Han M, Zhang HJ, Hong Z, Banathy A, Morrow E, Ryan JJ. Archer. Dynamin-related protein 1 (Drp1)-mediated diastolic dysfunction in myocardial ischemia-reperfusion injury: therapeutic benefits of Drp1 Inhibition to reduce mitochondrial fission. FASEB J. 2014;28(1):316–26.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Shirane M. Nakayama. Inherent calcineurin inhibitor FKBP38 targets Bcl-2 to mitochondria and inhibits apoptosis. Nat Cell Biol. 2003;5(1):28–37.

    Article  CAS  PubMed  Google Scholar 

  61. Wang G, Lu W, Shen WB, Karbowski M, Kaushal S, Yang P. Small molecule activators of mitochondrial fusion prevent congenital heart defects induced by maternal diabetes. JACC Basic Transl Sci. 2024;9(3):303–18.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

The present research was sponsored by the Chinese Academy of Medical Sciences (CAMS) Innovation Fund for Medical Sciences (CIFMS, 2022-I2M-1-020), Special Research Fund for Central Universities, Peking Union Medical College (PUMC) (3332023054), Non-profit Central Research Institute Fund of Chinese Academy of Medical Sciences (2023-PT180-01), National Key Research and Development Program of China (2022YEF0203200), and Beijing Natural Science Foundation (5172027).

Author information

Author notes

  1. Jiaxin Ma, Yaheng Wang and Huijiao Lv contributed equally to this work.

Authors and Affiliations

  1. National Center of Technology Innovation for Animal Model, Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, Peking Union Medicine College, Beijing, China

    Jiaxin Ma, Yaheng Wang, Huijiao Lv, Yu Lei, Feifei Guan, Wei Dong, Lianfeng Zhang & Dan Lu

  2. National Human Diseases Animal Model Resource Center, Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, Peking Union Medicine College, Beijing, China

    Jiaxin Ma, Yaheng Wang, Huijiao Lv, Yu Lei, Feifei Guan, Wei Dong, Lianfeng Zhang & Dan Lu

  3. Key Laboratory of Comparative Medicine, National Health Commission of China (NHC), Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, Peking Union Medical College, Beijing, China

    Jiaxin Ma, Yaheng Wang, Huijiao Lv, Yu Lei, Feifei Guan, Wei Dong, Lianfeng Zhang & Dan Lu

  4. Beijing Engineering Research Center for Experimental Animal Models of Human Critical Diseases, Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences, Peking Union Medicine College, Beijing, China

    Jiaxin Ma, Yaheng Wang, Huijiao Lv, Yu Lei, Feifei Guan, Wei Dong, Lianfeng Zhang & Dan Lu

  5. College of Life Sciences and Bioengineering, Beijing Jiaotong University, Beijing, China

    He Wang

  6. Building 5, PanjiayuanNanli, Chaoyang District, Beijing, 100021, P. R. China

    Dan Lu

Authors
  1. Jiaxin Ma
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Yaheng Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Huijiao Lv
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Yu Lei
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Feifei Guan
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Wei Dong
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. He Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Lianfeng Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Dan Lu
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Study concept and design: D.L. and L.Z.; performed experiment: J.M., Y.W., H.L., L.Y., F.G., W.D., H.W.; data analysis and interpretation: J.M., Y.W., H.L., D.L.; wrote the manuscript: D.L. and J.M. All authors edited and consented the final manuscript.

Corresponding author

Correspondence to Dan Lu.

Ethics declarations

Ethics approval and consent to participate

All animal studies were executed with approval from the Institutional Animal Care and Use Committee (IACUC) of the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College (IACUC-ZLF18001).

Consent for publication

No.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ma, J., Wang, Y., Lv, H. et al. Cytochrome P450 2E1 aggravates DXR-induced myocardial injury through imbalanced mitochondrial OPA1. Cell Commun Signal 23, 208 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12964-025-02197-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12964-025-02197-w

Cell Communication and Signaling

ISSN: 1478-811X